1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gavmur [86]
3 years ago
12

(2.01 MC) which of the following correctly describes the image below

Biology
1 answer:
Wewaii [24]3 years ago
3 0

You need to attach your picture to the question before you ask it

You might be interested in
Is there a difference in speed between a car going forwards at 5m/s and a car moving backwards at 5m/s
slava [35]

There is NOT a difference in speed between a car going forwards at 5 m/s and a car moving backwards at 5 m/s.

Speed is just the rate of change of the position of an object. It is calculated by dividing the change in position (distance traveled) by the time it takes to move said distance.

The distance between the two points is always positive because the direction does not matter.

However, if we are looking for the velocity, the direction DOES matter. In this example, the velocity moving forwards is 5 m/s while the velocity moving backwards is -5 m/s.

In other words:

<em>Speed </em>is looking at the <em>magnitude</em>

<em>Velocity </em>is looking at the <em>magnitude </em><em>and </em><em>direction.</em>

6 0
3 years ago
Directions
Vika [28.1K]

Answer:

hypothesis is an idea or explanation that then test through study and experimentation

7 0
2 years ago
What is the end result of the eukaryotic cell cycle?
REY [17]

A.) no parent cells and two daughter cells

I just took the test

7 0
2 years ago
Read 2 more answers
When lactose is present, the E. Coli will "turn on" the lactase gene.<br> True<br> False
Vaselesa [24]

Answer:

true

Explanation:

lactase is the enzyme that leads to the hydrolisis of lactose, when lactose is present the e coli needs to hydrolyse it to simple sugars so it needs to active the gene for lactase synthesis

4 0
3 years ago
Read 2 more answers
What subatomic particles are involved in chemical bonds
scoray [572]

Answer:

Actually, the ELECTRON: Negatively charged particles in an atom. Electrons, which spin around the protons and neutrons that make up the atom's nucleus, are essential to chemical bonding.

Explanation:

3 0
3 years ago
Other questions:
  • What do alcohol fermentation, acetyl CoA formation, and the Krebs cycle have in common?
    12·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • what is the sensitivity of freshwater wetland? I have to give three pieces of evidence and explain why it is sensitive or why no
    12·1 answer
  • Arrange the steps of energy production in the correct order.
    5·1 answer
  • What are some expiremental errors in yeast fermentation lab?
    7·1 answer
  • Pasteurization Select one: a. kills all vegetative forms. b. reduces the number of vegetative forms. c. reduces the number of en
    5·2 answers
  • Extra credit - My favorite cactus is Peniocereus greggi var. transmontanus, a night blooming cereus that has a gorgeous white fl
    10·1 answer
  • Structurally, DNA and RNA nucleotides are similar, although their three basic components differ slightly. One way DNA and RNA di
    9·1 answer
  • Environmental factors determine whether or not all genetic traits lead to health issues true or false?
    14·2 answers
  • Which type of statement proves a possible answer to a scientific question based on scientific knowledge
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!