1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eduardwww [97]
3 years ago
10

Why is the Big Bang Theory the leading theory on how our universe was

Biology
2 answers:
Vadim26 [7]3 years ago
7 0

Answer:

I think the answer is B.

scZoUnD [109]3 years ago
6 0

Answer:

The answer is B

Explanation:

A is wrong because many people do not believe in this theory, and C is wrong because according to the theory, it happened billions of years before humans were around.

You might be interested in
Please help ASAP for 50 POINTS (for quiz rn)
Anna71 [15]
Protons and neutrons are located inside the nucleus, while electrons are located outside. protons are positive, neutrons are neutral, and electrons are negative
3 0
3 years ago
Why do you feel the trachea expand when you're sitting upside down?
jenyasd209 [6]
I think its because when your upside down, your not breathing right. So its a way of trying to breathe correctly.
3 0
3 years ago
The study of biodiversity is called
kicyunya [14]
Biological diversity. It studies all living organisms and how they interact with each other and their environment.
7 0
3 years ago
All of the above'<br>'<br>'<br>'<br><br>]<br>l]p[][p][
SIZIF [17.4K]

Answer:

ummmmmm ok

Explanation:

6 0
3 years ago
A student wants to view a cell’s mitochondria. Which of the following microscopes would show a mitochondria’s internal structure
Olegator [25]

Answer:

Transmission Electron Microscope would show a mitochondria’s internal structure in the greatest detail

Explanation:

The TEM is used to visualise the internal structure of the cells. This works when an electron beam of light passes through the object or the sample, it shows a clear presence of the organelles inside the cell. The TEM uses the energetic electron which provides the morphological as well as compositional and crystallographic features of the cell. Its maximum potential is about 1 nanometre. Among the most powerful microscope for studying the internal organelles of the cell TEM is one.

5 0
3 years ago
Other questions:
  • When a physical ailment has no apparent medical cause, doctors may suspect a _________ disorder?
    12·1 answer
  • A protein may consist of as many as _____ amino acid molecules.
    15·1 answer
  • in a tropical rain forest,the layer formed by the leafy tops is called the ____ and the layer of shorter trees and vines are cal
    6·1 answer
  • eggs are used in alot of baking goods eaten over thanksgiving. eggs only have one set of chromosomes. list three vocabulary word
    5·1 answer
  • Even with large quantities of food available, people in the United States can experience diseases such as heart disease, stroke,
    14·1 answer
  • 8. In the diagram below, which substance belongs in are: Z? Living Organisms include Chemical Compounds that can be Organic whic
    9·1 answer
  • Salt water is classified as a blank and a solution
    5·1 answer
  • What happens in an ad hominem persuasive technique? A limited number of options are presented. A person is attacked rather than
    14·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • "Living things are found in their habitats. They interact with each other and their environment. This interaction is between bio
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!