AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Parents: Homozygous brown-eyed (M) -
B B blued-eye (F) -
b b [since blue (b) is recessive then and brown (B) is dominant then
in order for the blue gene to
show the you need double recessive or the brown
gene absent
Offspring:
So based on the Punnett cross then you realize that all the possible of spring carry the
genotype B b and as such the
phenotype brown eyes
Because it helps the environment strive and keep its self alive my controlling populations and bringing in new ones
Coevolution happens when the genetic development between two or more species affects the evolution of each other. An example would be hummingbirds and bird-pollinated (ornithophilous) flowers. The ornithophilous flowers give nourishment to the birds with their nectar that has high sugar content. The birds in return aids in the pollination of these flowers.
Microfilaments
Microfilaments are fine, thread-like protein fibers, 3-6 nm in diameter. They are composed predominantly of a contractile protein called actin, which is the most abundant cellular protein. Microfilaments' association with the protein myosin is responsible for muscle contraction. Microfilaments can also carry out cellular movements including gliding, contraction, and cytokinesis.
Microtubules
Microtubules are cylindrical tubes, 20-25 nm in diameter. They are composed of subunits of the protein tubulin--these subunits are termed alpha and beta. Microtubules act as a scaffold to determine cell shape, and provide a set of "tracks" for cell organelles and vesicles to move on. Microtubules also form the spindle fibers for separating chromosomes during mitosis. When arranged in geometric patterns inside flagella and cilia, they are used for locomotion.
Hope this helps :)
