1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nekit [7.7K]
3 years ago
15

All chemical synapses exhibit the same general sequence of events during the transmission of information across the synaptic cle

ft. This sequence is always initiated by an action potential that travels down the presynaptic cell (the sending neuron) to its synaptic terminal(s).Sequence of events?
Biology
1 answer:
Ne4ueva [31]3 years ago
4 0

Answer:

1. The presynaptic neuron reaches the synaptic knob and the terminal is depolarized.

2. The electrical voltage gated calcium channels in the presynaptic knob opens.

3. The calcium ions enters through the calcium channel, this calcium ions cause the fusion of the synaptic vesicles to the presynaptic membrane, the cell membrane of an axon terminal that faces the receiving cell.

4. There is neurotransmitter release by the axon terminal of a neuron and bind to and react with the receptors on the dendrites of another neuron e.g. acetylcholine by exocytosis.

5. Acetylcholine diffuses across the synaptic cleft and bind to receptors on the postsynaptic neuron, that is a neuron to the cell body or dendrite of which an electrical impulse is transmitted across a synaptic cleft by the release of a chemical neurotransmitter from the axon terminal of a presynaptic neuron.  

6. This causes sodium ion channels in the postsynaptic neuron to open, and sodium ions diffuse in.

7.  Excitatory (excited neurons) postsynaptic potentials are created, and if these generator potentials are sufficient then the postsynaptic terminal reaches threshold potential and there is propagation.

Explanation: The nervous system is made up of billions of specialized cells called neurons, it is crucial to have an efficient communication between neurons for normal functioning of the central and peripheral nervous systems. The presynaptic action potential refers to an action potential of neuron before synapse. The above is the sequence of event during the transmission of information across the synaptic cleft

You might be interested in
If a white dog with a short tail is crossed with a dog that is hom0zygous for black fur and heterozygous for a long tail, what i
timama [110]

Answer:

50

Explanation:

6 0
3 years ago
Read 2 more answers
In which of the following biomes is annual precipitation lowest?a. tundrab. taigac. grasslandd. temperate deciduous foreste. tro
saveliy_v [14]

Answer: Option A.

Tundra

Explanation:

Tundra biome have the lowest annual precipitation because it is the coldest of all the biomes and it is plain without trees and have frost molded land scape. It have low or poor nutrients which do not support plants growth, low temperature or have the lowest temperature, little precipitation and short growing seasons.

It's annual precipitation is less than 25 centimeter annually and they are also considered as desert, after the short growing seasons, it is followed by harsh conditions which the plants and animals present there posses a special type of adaptation for survival in the area. They are found in high altitude landmass such as Canada, Russia, Alaska e.t.c.

7 0
3 years ago
Please help I will fail and I’m confused
katrin2010 [14]

Answer:

b- a genetic mutation must have occurred

Explanation:

4 0
3 years ago
Someone who can help me please thank you?
Sunny_sXe [5.5K]

Answer:

The dna added on is to give the corn more strenghth

Explanation:

3 0
3 years ago
How does color differ from streak​
olasank [31]

Answer:

<em>Hope this helps</em>

Explanation:

<em>Streak is the color of a minerals powder when it is crushed. Some minerals have a different color powder than their actual color. Every mineral has an inherent streak no matter what color it is. ... Most mineral references don't make a distinction between a white or colorless streak, since the difference is minimal.</em>

4 0
3 years ago
Other questions:
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • 1. True of False: rRNA refers to regular RNA.
    11·2 answers
  • According to evolutionary theory, humans should be able to judge the trait of ________ more accurately than other traits that ar
    9·1 answer
  • The atomic number of an atom is the number of
    5·2 answers
  • Genetic diversity is the variation in the genes of an entire species. Each circle represents a population of a particular specie
    11·2 answers
  • Blood type can receive Rh+ or Rh- blood
    12·2 answers
  • What are monomours? <br>​
    8·2 answers
  • examine this image in the image there is a red mum parent and white mum parent What is the most likely genotypes of the parents
    12·1 answer
  • Explain why society has been developing different renewable resources in favor of
    12·1 answer
  • What is the common function of leaves?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!