Answer:
<em>between </em><em>an </em><em>animal</em><em> </em><em>cell </em><em>and </em><em>a </em><em>plant </em><em>cell </em><em>there </em><em>are </em><em>some </em><em>parts </em><em>that</em><em> </em><em>are </em><em>similar</em><em> </em><em>and </em><em>carry </em><em>out </em><em>the </em><em>same </em><em>function </em><em>like:</em>
<em>both </em><em>have </em><em>a </em><em>cell </em><em>membrane</em><em> </em><em>which </em><em>selects </em><em>what </em><em>goes </em><em>in </em><em>the </em><em>cell.</em>
<em>both </em><em>have </em><em>cytoplasm</em><em> </em><em>which </em><em>holds </em><em>the </em><em>protoplasm(</em><em>the </em><em>living</em><em> </em><em>part </em><em>of </em><em>the </em><em>cell)</em>
<em>both </em><em>have </em><em>a </em><em>nucleus</em><em> </em><em>which </em><em>carries </em><em>out </em><em>all </em><em>cell </em><em>activities</em><em> </em><em>and </em><em>holds </em><em>threads </em><em>of </em><em>DNA </em><em>called </em><em>chromosomes</em>
<em>both </em><em>have </em><em>a </em><em>mitochondria</em><em> </em><em>which </em><em>is </em><em>the </em><em>power </em><em>house</em><em> </em><em>of </em><em>the </em><em>cell</em>
<em>both </em><em>have </em><em>golgi </em><em>bodies </em><em>which </em><em>modify</em><em> </em><em>and </em><em>carry </em><em>proteins</em><em> </em><em>from </em><em>sites </em><em>of </em><em>synthesis</em><em> </em><em>to </em><em>sites </em><em>of </em><em>reaction</em>
<em>I </em><em>hope</em><em> this</em><em> helps</em>
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Canada as it is far from the equator
Answer:
The correct answer is option B. "Raoul's practice is massed; Scarlett's is distributed".
Explanation:
A massed practice condition is defined as a task that its performed by an individual without taking a significant amount of rest. Since Raoul is only taking 5 seconds of rest between trials, his practice is massed. On the other hand, distributed practice conditions involve resting for longer periods of time. Scarlett is resting 40 seconds between trials, which represents a longer period of time that the trial itself (30 seconds), therefore her practice is distributed.
