1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melamori03 [73]
3 years ago
10

Was Durer Roman Catholic or Protestant?

Biology
2 answers:
dsp733 years ago
6 0

Answer: im not one hundred percent sure this is correct but i think it is Catholic if im right can you mark me as brainiest

Explanation:

Elza [17]3 years ago
4 0
He was Catholic, but had many sympathies towards Protestant ideas, especially Martin Luthers.
You might be interested in
What organelle packages molecules? A. Centrosomes B. Golgi Apparatus C. Nucleus D. Ribosome
klio [65]
The organelle that packages molecules for transport outside the cell is the Golgi Apparatus. The molecules are packages in transport vesicles inside the Golgi Apparatus.

The solution is C.
8 0
2 years ago
For an organism to be classified in the animal kingdom, which characteristics must the organism have?
vovikov84 [41]

Explanation:

All animals are eukaryotic, multicellular organisms, and almost all animals have specialized tissues. Most animals are motile, at least during certain life stages. Animals require a source of food to grow and develop. All animals are heterotrophic, ingesting living or dead organic matter.

4 0
2 years ago
Why do scientists monitor the effect of each method
Fiesta28 [93]
The answer is B since climate change is already a huge issue in today’s society
4 0
2 years ago
If an organism's body cells have 12 chromosomes, how many chromosomes will the sex cell have
Fynjy0 [20]
23 and  for the female and for the male there are 46 
3 0
3 years ago
What would have happened if Avery had added an enzyme that digests it all the nucleus acids in the mixture of heat-killed bacter
telo118 [61]
The answer is most likely B). 'The harmless bacteria would not have been transformed, and the mice would have lived,' because, then bacterium transform, they use the genetic material present in their environment to do so, and when Avery destroyed the nucleotide bases(Genetic material) with an enzyme he destroyed any chances that the bacteria would have had at transforming into the virulent strain.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is not a negative factor of nonnative species?
    12·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which conditions are equal to stp
    12·2 answers
  • List two species that are clear examples of genetic drift and speciation events.
    14·1 answer
  • Canada, Russia and _____ are areas of large oil reserves.
    7·2 answers
  • Which volcanoes have a clearly layered structure? Select all that apply.A.cinder coneB.stratovolcanoC.shield volcano
    13·2 answers
  • An atom is the smallest complete part of a(n) __________ that still has all the original properties of this substance.
    9·2 answers
  • This answer is B right? :)
    11·2 answers
  • What is the best way for people to deal with stress.??
    12·1 answer
  • Which of the following diagrams illustrates the position of t3
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!