1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reil [10]
4 years ago
14

Can someone please help me

Biology
1 answer:
Andrews [41]4 years ago
7 0
<span><span>absorbed: </span>Became a part of something bigger.<span>affiliated: </span>Allied with, working together.<span>counterparts: </span>Parallels, the same.<span>environmentalism:</span>Advocacy of eco-friendly practices and policies.<span>noninterventionist: </span>One who removes self from participation.<span>third parties: </span><span>Parties in opposition to the two dominant parties.</span></span>
You might be interested in
Do Heterotrophs convert solar energy into chemical energy.
lubasha [3.4K]
No, heterotrophs do not covert solar energy into chemical energy. Heterotrophs are organisms, like humans, that find their own food. They can not physically make their own food because they can't use the process of photosynthesis. So, heterotrophs hunt or gather their own food. 

4 0
3 years ago
Were are chromosomes found in an animal cell?
Mademuasel [1]

Chromosomes are found in the nucleusof animal and plant cells.

7 0
3 years ago
It possible to determine carrying capacity of your population from the model? the Why or why
Maurinko [17]
According to reasearch it isn't possible
4 0
3 years ago
What is the tRNA anti-coden sequence for GCU mRNA?
Assoli18 [71]
What do you meannnnnnn
6 0
3 years ago
I’ll put you as brainliest 10points !
vredina [299]

Answer:

Part 1:D) Fertilization

Part 2: C) The process combines genes from two individuals into a distinct organism.

Explanation:

99% sure its correct

3 0
4 years ago
Other questions:
  • What distinguishes the savanna and grassland biomes?
    15·1 answer
  • What happens to energy as you move up food chain
    6·2 answers
  • Scientists find dense rock on Earth's surface that is made of magnesium and smaller amounts of silicon. What layer of Earth migh
    5·2 answers
  • What is the name of the hair-like structures on sponge cells that move back and forth to help move water, nutrients, and waste t
    11·2 answers
  • Look at the following mutation: AUG-GUC-CCU-AAA → AUG-AGU-CCC-UAA-A. The base A was inserted following the start codon AUG. Desc
    13·1 answer
  • Whats the relationship between enzymes and sunstrates?
    6·2 answers
  • The distance from Saturn to Earth is 10 AU. What is the distance, in kilometers, between Saturn and Earth? 1 million kilometers
    11·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • The seahorse is an unusual example of a(an) species because the male incubates the eggs in a pouch before giving birth to fully
    12·2 answers
  • PSYCHOLOGY <br> Briefly describe the relationship between hormones, emotion, and external behavior
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!