1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
koban [17]
3 years ago
14

Mutations that occur without a known cause are known as:

Biology
1 answer:
SpyIntel [72]3 years ago
4 0

Answer:

a. spontaneous mutations

Explanation:

<em>Spontaneous mutations </em>occur randomly in all cells and without any agents. <em>Induced mutations </em>are the result of some exposure to a physical or chemical agent called a mutagen. Mutations can be classified as <em>harmful and adaptive</em> regardless of whether they were spontaneous or induced mutations. The reversal mutation is when a given mutation is reversed by another mutation so that the nucleotide is changed back to its original state.

You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Carbon is used to make *
Bezzdna [24]

Answer: Lysozymes

Explanation:

6 0
3 years ago
Read 2 more answers
Why is biomass a better alternative to natural gas?
ludmilkaskok [199]
I believe the answer is C but I’m not completely sure
3 0
3 years ago
Humans’ use of rocks and minerals as building materials is an example of which interaction? an interaction within the geosphere
Shalnov [3]

The correct answer is: an interaction between the biosphere and the geosphere.

The geosphere represents all of the rocks, minerals and ground that are found on and in Earth. It includes the ocean floor, all of the rocks on the surface, and all of the sand in the deserts.

Biosphere on the other hand is composed of all the living organisms on Earth (including human).


6 0
3 years ago
Read 2 more answers
A type of genetic drift that occurs after a small number of individuals begin to live in a new area
chubhunter [2.5K]
The founder effect is the answer
5 0
3 years ago
Other questions:
  • When stephen looks out at a field of red, purple, and yellow tulips, he can only see shades of gray. his condition is?
    7·1 answer
  • What organ secretes antidiuretic hormone
    6·1 answer
  • Which best describes the role of auxin?
    12·2 answers
  • Which of the following fruits comes from the fragaria plant?
    9·1 answer
  • Is it normal to lose a lot of weight after having a stomach bug?
    8·1 answer
  • How do fish get there colors?
    13·2 answers
  • Some people choose to have health screenings performed through genetic analysis what is a direct benefit of this analysis?
    10·1 answer
  • 1)Plants and animals need a sugar called glucose in order to make ————— energy in a process called————.
    12·1 answer
  • How does the union of rootstock and scion take place?
    14·1 answer
  • Which statement about the visible light spectrum is true when moving
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!