1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Westkost [7]
3 years ago
10

Rip currents are caused by _____.

Biology
2 answers:
Nataly_w [17]3 years ago
6 0
Rip currents are caused by breaks or changes in longshore currents.

Waves continually break upon the shore one after the other, they never stop.Water from previous waves runs underneath the waves currently breaking on the shore. This creates a gentle current that runs along the bottom of the ocean, which pull toward the ocean floor. That is mild than a rip current that doesn't present any danger.

ludmilkaskok [199]3 years ago
3 0

Breaks or changes in longshore currents

You might be interested in
The process of moisture being released from the leaves of trees and plants into air
steposvetlana [31]

Answer: Evaporation

Explanation:

8 0
3 years ago
All of the following are conditions that organisms in a tidepool must withstand except
NeX [460]
 d bc (a b c  and d) r the same to make a tidepool
3 0
3 years ago
Helium nuclei are more difficult to fuse than hydrogen nuclei because they have a greater positive charge.
nataly862011 [7]
<span>Helium nuclei have a positive charge of 2+ when observed. Compared to a hydrogen nuclei, we can see that the Helium nuclei is more difficult to fuse as it has a greater charge than Hydrogen 1+. This chemical difference makes the answer true.</span>
6 0
3 years ago
Whodunnit?
Sauron [17]
The file above is a scam file
5 0
3 years ago
BRAINLIEST!!!!! PLEASE HELP!!!!!
erastovalidia [21]

I don’t know, I’m sorry.

6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A forest is home to a large population of flies with high genetic diversity. A nearby factory has
    8·1 answer
  • Explain the steps (5) that would need to take place for primary succession to occur.
    12·1 answer
  • Describe how a person's activity level can affect their health
    10·2 answers
  • Easy 100 points for one question
    13·2 answers
  • Can enzyme fit everything
    8·2 answers
  • What is the main difference between heterotrophs
    8·2 answers
  • Which characteristic of viruses prevents them from being used as evidence to support cell theory?
    15·1 answer
  • which of the following statements is true? hydroelectric power does not damage the environment. waste from nuclear power plants
    10·2 answers
  • Complete Homework Questions from Pages 340-350 of California Experience Biology the Living Earth
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!