1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Furkat [3]
3 years ago
11

It is cloudy outside so it is probably going to rain. This statement is:

Biology
1 answer:
zloy xaker [14]3 years ago
5 0

Answer:

Inference

Explanation:

It is an inference because they have no other evidence other than the fact that it is cloudy outside

You might be interested in
Mach is 750 mph and is known as the <br><br><br> The Right Stuff
ser-zykov [4K]
What is the problem here
5 0
3 years ago
Describe how physical and chemical changes affect mass
AlladinOne [14]

Answer:

Explanation:

Matter can change form through physical and chemical changes, but through any of these changes matter is conserved. The same amount of matter exists before and after the change—none is created or destroyed. This concept is called the Law of Conservation of Mass.

5 0
2 years ago
What’s the answer??<br><br><br><br><br> not correct about compact bone
Vaselesa [24]
I think it’s the first one
7 0
2 years ago
If someone adds thousands of small fish to a lake, how would the number of big fish change?
bearhunter [10]

Answer:

the number of big fish would increase

Explanation:

when theres a bunch of small fish, that is more food for the big fish ao the population of big fish will increase

5 0
4 years ago
Read 2 more answers
Glucose or Water ? A or D
Contact [7]

Answer:

C Oxygen

Explanation:

7 0
3 years ago
Other questions:
  • What is a limiting factor of populations?​
    8·1 answer
  • What type of cell has no membrane-bound nucleus?
    12·1 answer
  • A student is studying the amino acid sequence of a protein shared by four organisms. The student wants to know which organism is
    11·1 answer
  • People who tend to perceive the elements of their environment as
    13·1 answer
  • Immunity from vaccination
    5·1 answer
  • What valuable information was gained from Mendel's dihybrid crosses?
    15·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • How many chromosomes do birds have.
    10·2 answers
  • Ella has a mass of 56 kg, and Tyrone has a mass of 68 kg. Ella is standing at the top of a skateboard ramp that is 1.5 meters ta
    11·1 answer
  • CHROMOSOMES AND INHERITANCE VOCABULARY REVIEW Distinguish between the terms in each of the following pairs of terms. X-linked ge
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!