1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikitadnepr [17]
3 years ago
11

Which of the following is a component of potting soil

Biology
2 answers:
Karo-lina-s [1.5K]3 years ago
8 0
Topsoil is the answer
slava [35]3 years ago
6 0
The answer is B topsoil<span>. The potting soil</span>, is use for cultivating floors, grasses and vegetables in a handle or container. <span>The potting soil</span><span> available in trades is sterilized in order to avoid the spread of bad grasses and diseases transmitted by the plants.</span>
You might be interested in
Which perspective most clearly focuses on how we learn observable responses? a psychodynamic b humanistic c evolutionary d biolo
IgorC [24]
The answer is C. Evolutionary
5 0
3 years ago
Read 2 more answers
Juan is working with a darkfield microscope with a numerical aperture (NA) of 1.25, Ali is working with a brightfield microscope
Alex

Answer:

Juan

Explanation:

Given the information from the question. We need to find out which person will get the best resolution and the reason thereafter. Since we know that the resolution is directly proportional or relative to N (A). Based on the information provided .Juan will have the best resolution due to higher N (A). Therefore, the correct answer is Juan.

5 0
3 years ago
What are the chances that a cross between a black chicken and white chicken will result in blue offspring?
Shkiper50 [21]

The correct answer is 100%

This is because Back and white are both incomplete dominant traits. When you cross these together, all (100%) of the offspring will be heterozygous blue.

I just took the test on USATestPrep, so I guarantee you that is correct!

Have a great day! :)

4 0
3 years ago
Four children in a family have four different blood types. If the father has
Natali5045456 [20]
I think BO or B, but BO has more chance.
6 0
2 years ago
What have scientists learned about elephant shrew based on DNA evidence ?
Alex777 [14]
<span>Most elephant shrew species were first describedin the 1800s by scientists who ... DNA evidence is very conclusive and some say 99% accurate, however it is possible to challenge it based upon faulty collection and/or faulty lab techniques.</span><span>
</span>
3 0
3 years ago
Other questions:
  • When a pendulum is held high and taut and then is released, the pendulum begins to swing. What’s the correct order of the energy
    5·1 answer
  • Which life process is necessary for the survival of a species but not necessary for the survival of the individual organism?
    7·1 answer
  • As the average kinetic energy of a substance increases, the internal energy , and so its thermal energy . as the thermal energy
    13·2 answers
  • All living things contain organic compounds.<br><br> True<br><br> False
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • I need the answer please
    6·2 answers
  • In an experiment to test a new drug’s effectiveness, one group is given a larger dosage than is typically prescribed, and a seco
    14·2 answers
  • Which of the following statements correctly determines the process when following the scientific method?
    13·1 answer
  • The region known as the macula densa is part of
    6·1 answer
  • Which of the following is NOT an example of radiant energy?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!