1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natka813 [3]
3 years ago
11

If the answer is right i will give Brainlyiest answer.

Biology
2 answers:
PtichkaEL [24]3 years ago
7 0
Gulls because they feed of them
maxonik [38]3 years ago
7 0
Gulls are most likely to be infected 
You might be interested in
BRAINLIESTTTT ASAP!!!!!
Talja [164]

The plasma membrane needs lipids, which make a semi-permeable barrier between the cell and its environment. It also needs proteins, which are involved in cross-membrane transport and cell communication, and carbohydrates, which decorate both the proteins and lipids and help cells recognize each other. Hope this helps :)

6 0
3 years ago
A food contains 28 g carbohydrates 2.7 G protein and 0.3 fats
d1i1m1o1n [39]
I hope this help, answer is 125.5kcal‍♀️
7 0
3 years ago
Darla was in an automobile accident that resulted in an injury to her brain. her sense of touch has been affected. which part of
meriva
I believe the answer to your question is the p<span>arietal lobes</span>
3 0
3 years ago
Read 2 more answers
A geologist notices that the land on one side of a break in the crust is slightly higher than the other side. What has the geolo
BartSMP [9]

Um D? A fold?? If its right mark as brainleist please

4 0
3 years ago
The limbic system is responsible for ____________. connecting the brain to the rest of the body fighting disease organisms that
Nina [5.8K]

The limbic system is responsible for controlling learning and emotional behavior

5 0
3 years ago
Other questions:
  • when we look at a leaf, we see the colors of light that are reflected off its surface. how does the relatively low flow of oxyge
    8·1 answer
  • This is the role of a species in an ecosystem, consisting of such things as what it eats, when it eats, and where it lives.
    14·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Why did gregor mendel study pea plants?
    6·2 answers
  • Pavlov's dog stopped salivating to the tone when the food was no longer paired with the tone. this is an example of _____.
    12·2 answers
  • Which of these statements best explains the process of energy conversion that takes place in the mitochondria?
    9·1 answer
  • Uestion пром How many atoms are approximately in one grain of sand?​
    12·2 answers
  • Why does the author of the perils of indifference suggest that indifference only benefits the enemy
    8·1 answer
  • Which statement is true about water molecules?
    7·1 answer
  • at 21 degrees celcius, a cell with a pressure potential of 3.2 bar is at equilibrium with a 0.420 sucrose solution in an open be
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!