1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natima [27]
3 years ago
11

For any point in Earth's surphase, its height above sea level its called its _______?

Biology
1 answer:
Zarrin [17]3 years ago
5 0

I believe the term is ELEVATION

You might be interested in
What is the importance of adaptation as a mechanism for the survival of species?
Nana76 [90]

Animals can defend themselves against predators and extreme weather by adapting. Numerous birds may conceal themselves under long grass, while weeds, insects, and other creatures can alter their color to blend in. Predators find it challenging to locate them in search of food as a result.

<h3>What are species?</h3>

A species is a unit of biodiversity as well as the fundamental classification and taxonomic rank of an organism in biology. The biggest group of organisms in which any two individuals of the right sexes or mating types can conceive a fertile offspring, usually by sexual reproduction, is referred to as a species. A species can also be identified by its karyotype, DNA sequence, anatomy, behavior, or ecological niche. In addition, since fossil reproduction cannot be studied, paleontologists use the chrono species idea.

<h3>What are the different types of species?</h3>
  • Typological Species
  • Nominalistic Species
  • Biological Species
  • Evolutionary Species
  • Taxonomic Species.
  • Microspecies.
  • Biological Species.
  • Evolutionary Species.

To learn more about species visit:

brainly.com/question/13259455

#SPJ4

8 0
2 years ago
Are examples of carbohydrates
Verdich [7]

Answer:

glucose & fructose

Explanation:

please mark me brainliest.

7 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which best describes the fossil record?
Sonbull [250]

The correct answer choice is answer B.) The fossil record provides evidence of a common ancestor to many species. Hope this helped!

7 0
3 years ago
Read 2 more answers
Features are inherited characteristics or structures. <br> True or False
seraphim [82]

Answer: True

Explanation: DNA is a feature people have, as well as characters. You may look like your mother or father... But your features is what makes you look a certain way.

This may not be much help, but I tried!!!

8 0
3 years ago
Other questions:
  • These liver cells will conduct _____ to grow back. binary fission multiple fission mitosis meiosis
    5·2 answers
  • How will this mutation affect the golden retriever puppy?
    5·1 answer
  • In your own words, explain the processes responsible for the formation of a reverse fault.
    8·1 answer
  • Which building or business in the city represent the mitochondria and why?
    7·1 answer
  • Choose the best synonym to replace the underline word in the sentence below: These fossil fuels emit carbon dioxide into the air
    10·1 answer
  • 35 points
    9·2 answers
  • Non-renewable natural resources like oil and natural gas take a very long time to form. That is one reason for the building of w
    8·1 answer
  • 1. What is forensic entomology? What are the different areas of forensic entomology?
    9·1 answer
  • What simple machines have been used on pyramid? What advantages do they give?
    11·1 answer
  • Before conducting an experiment, a scientist needs to review _____.
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!