Hello!
<h3>⭐What does polar mean? </h3>
--------------------------------------------------------------------------------------------------------------------------------------------
- D. An unequal sharing of electrons
--------------------------------------------------------------------------------------------------------------------------------------------
<em><u>Chemical polarity or only polar is a property of molecules that represents the separation of electric charges in the same molecule (see also electric dipole). ...</u></em>
I hope I have helped you :D
greetings
atte:
<u>Angela</u>
❤️
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:
thanks to the genetic code, this allows cells to decode an mRNA in an amino acid chain
Transfer RNAs, or tRNAs, connect the mRNA codons with the amino acids for which they encode. One end of each tRNA has a three nucleotide sequence called anticodon, which can be attached to a specific codon of the messenger RNA. The other end of tRNA carries the amino acid that specifies the codon that is present in the messenger RNA
A citric acid cycle is less active when a cell has a high atp/adp ratio and high nadh/nad ratio.
<h3>What is cell and cell theory?</h3>
A cell is the structural and functional unit of life and it the the base of an living organism.
Cell theroy is a scientific theroy that's help to learn how living organisms are made up of cells, that's they are the basic structure unit of all organisms, and that all cells from pre-existing cells.
Prokaryotic cells are single-celled microorganisms known to be earliest on earth.Eukaroyatic cells have a nucleus enclosed within the nuclear membrane and form large and complex organism.
The main difference between unicellular organisms and multicellular organisms is that unicellular organism is unspecialized it means all the body function depends upon only on the single cell and in multicellular organism there is specific cells for specific purposes.
Therefore,a citric acid cycle is less active when a cell has a high atp/adp ratio and high nadh/nad ratio.
Learn more about cell here:
brainly.com/question/3142913
#SPJ4
