1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lera25 [3.4K]
2 years ago
10

What a the difference between microfilaments and microtubules?

Biology
1 answer:
docker41 [41]2 years ago
6 0

Answer:

The main difference between microtubules and microfilaments is that microtubules are long, hollow cylinders, made up of tubulin protein units whereas microfilaments are double-stranded helical polymers, made up of actin proteins.

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
2 years ago
The atmosphere is 80% nitrogen: why do you think plants and animals can't use nitrogen as it is found in the atmosphere?
Setler [38]

Answer: Atmospheric Nitrogen is unreactive

Explanation:

The atmosphere is made up of about 80% Nitrogen, 16% oxygen, about 4% carbon dioxide, rare gases etc.

However, the 80% Nitrogen is highly unreactive, and needs to be trapped by competent micro organisms known as nitrogen-fixing bacteria in the root nodules of legumes.

Then, it is converted to several forms like nitrites, nitrates (easily absorbed by plants), ammonia and finally escape to the atmosphere again.

This brief illustration explains the NITROGEN CYCLE, and it is the only means by which plants and animals can use the highly unreactive nitrogen

3 0
3 years ago
Read 2 more answers
Anyone wants to do dirty zoo m​
kenny6666 [7]

Answer:

NOO pls

Explanation:

Please Mark me brainlist

4 0
3 years ago
Which tool is used to track which organisms are carriers of a specific trait through several generations?
const2013 [10]
A pedigree or a pedigree chart is used to track which organisms are carriers of a specific trait through several generations.

C.
8 0
3 years ago
Hey happy winter holiday! take some points fellow goblins also I hope you have a day and don't forget to eat something because y
dimulka [17.4K]

Answer:

Thank you! :) you are awesome and happy holidays to you!

Explanation:

Ya your stomach hurts when something else happens and that REALLY sucks lol!

Although its not really you stomach and more like intestines but still REALY sucks.

5 0
3 years ago
Other questions:
  • Which human activity has had the greatest impact on climate change?
    13·1 answer
  • Proteins that eukaryotes use to turn genes on and off by allowing transcription to occur or blocking it are called _____________
    9·1 answer
  • Every cell in the human body contains the same set of instructions. Why is it that some cells are muscle cells, some cells are n
    10·1 answer
  • A scientist engineers a virus that contains the gene thought to provide bacterial resistance to the antibiotic vancomycin. The s
    15·1 answer
  • What are the basic steps of scientific method? (specifically, I think there are 5 specific steps)
    8·2 answers
  • Scientists are trying to engineer non-legume crop plants, such as corn, wheat, and rice, to form symbiotic relationships similar
    15·1 answer
  • Which statement best describes how panting after running helps a person's body maintain homeostasis? EXPLAIN THE ANSWER
    14·2 answers
  • PLEASEEEE HELPPPPPPPPPPP
    14·1 answer
  • What are the 3 types of plate boundaries and their movement in relationship to another<br> plate?
    15·1 answer
  • While many marine resources are potentially renewable resources, they're presently not renewable. Explain
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!