1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Savatey [412]
3 years ago
15

Which is a quantitative method of data collection?

Biology
1 answer:
uysha [10]3 years ago
7 0

Answer:

numbers

Explanation:

If you were to gain Quantitative data that would mean that the data includes numbers such as there were five students with a syndrome. on the other hand, there is qualitative data. Qualitative data is a description of something, like the dots on a small object.

You might be interested in
What is the main function of the crispr-cas9 system?
Rainbow [258]

Answer:

CRISPR-Cas9 is a unique technology that enables geneticists and medical researchers to edit parts of the genome? by removing, adding or altering sections of the DNA? sequence. It is currently the simplest, most versatile and precise method of genetic manipulation and is therefore causing a buzz in the science world.

Explanation:

Hopefully this helps you if it does please mark brainliest

8 0
3 years ago
Is most of the tubule filtrate reabsorbed into the body or excreted in urine explain?
Airida [17]
I believe the answer to this question is the filtrate is reabsorbed.
This is brought into the system because it still contains the useful products for other biological processes.   Thank you for your question. Please don't hesitate to ask in Brainly your queries. 
5 0
2 years ago
What are cumulonimbus clouds?
Mazyrski [523]

Explanation:

Cumulonimbus clouds are a type of cumulus cloud associated with thunder storms and heavy precipitation. They are also a variation of nimbus or precipitation bearing clouds. They are formed beneath 20,000 ft. and are relatively close to the ground. ... These clouds often produce lightning in their heart.

7 0
3 years ago
Describe the characteristics of a river that would be a good source of freshwater (2-3 sentences)
Anton [14]
A river that comes from rain, glaicers etc would be a good example of fresh water rivers. Cause the water is coming from something that is most likely been unthouched by man or has been filterd and cleaned from minerals in the ground.
8 0
3 years ago
Read 2 more answers
Uplift and formation of a mountain range divides a fox species into two isolated populations. Erosion eventually lowers the moun
inysia [295]

Answer:

Allopatric speciation

Explanation:

Speciation is the gradual process by which two different species are formed from a single species due to evolution.

Allopatric speciation will occur when the speciation is due to geographical isolation of a species to the extend it prevents or interferes with the gene flow. Therefore, the populations can not mate with each other and they evolve separately.

This is what happened to the fox species when they were separated by a mountain range.  

8 0
3 years ago
Other questions:
  • Question 10(Multiple Choice Worth 2 points)
    11·1 answer
  • The LEAST LIKELY reason for Cubans to migrate mostly to Miami since the 1960s was the A) American dream. B) better climate. C) p
    9·2 answers
  • What the answer to this question
    7·1 answer
  • is bornite dull or shiny? is Chalcopyrite dull or shiny? is pyrrhotite dull or shiny? is goethite dull or shiny? in other words
    6·2 answers
  • Differences between archaea and bacteria
    10·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • The free-energy changes of the individual steps in a pathway are summed to determine the overall free-energy change.
    11·2 answers
  • Earth's tectonic plates A. are constantly in motion. B. move only once. C. move only up and down. D. do not move.
    6·2 answers
  • PLSSS HELP ASAP
    5·2 answers
  • Which of the following DOES NOT regularly use the atmosphere during its process?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!