All categories

3 years ago

Hello, if any one knows how to fill in a punnet square please help meeeeee

Biology

2 answers:

Svetradugi [14.3K]3 years ago

5 0

Write the letters then go down then across.

omeli [17]3 years ago

3 0

You can fill the sides with any allele.
After that the first box will be the dominant allele than the recessive allele, the box below that will be the dominant allele and the recessive allele. Dom being capitol and recessive being lowercase, the box on the top right will be dominant allele and recessive and bottom dominant and recessive. It’s all based on the allele of that row and column.

You might be interested in

PLSSS HELP GIVING BRAINLIEST

raketka [301]

Answer:

its a,b,d

Explanation:

3 0

3 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

What was one of the ways that people of ancient times classified plants and animals?

Rudik [331]

The answer is: by use

7 0

3 years ago

What is this desert biome composed of? Select all that apply.

Nat2105 [25]

This biome has a layer of soil that can either be sandy, gravelly, or stony, depending on the type of desert. Deserts usually get at most 50 centimeters (20 inches) of rainfall a year, and the organisms that live in deserts are adapted to this extremely dry climate. Plants in deserts have adaptations to conserve water.

6 0

3 years ago

Are the counts of blue crabs in Maryland accurate for 1991 and 1999?

kirill [66]

The population of blue crabs will be difficult for the scientists to count because of unreliable ways and natural phenomenon or occurrence that causes the water's temperature to rise. According to climate reports, year 1999 have warmer temperature and this probably caused the blue crabs to be active, but on year 1990 female blue crabs sustained a normal quantity of production of their species. Thus, the estimated count of population of blue crabs is probably more accurate in year 1990 than year 1999 because of the stable production of the female crabs.

5 0

3 years ago