1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
5

A titratable group is in the active site of an enzyme and must be protonated for the enzyme to function. Assume that the group h

as a pKa of 6.5 and that the activity is proportional to the fraction of molecules in the protonated state. Which of the following are true?
1. At pH 9.0 close to 100% of the enzyme molecules are active.
2. At pH 9.0 close to 100% of the enzyme molecules are inactive.
3. At pH 6.5 the enyzme is 50% active.
4. At pH 6.8 the enzyme is 66.6% inactive.5. At pH 7.2 there are about 5 inactive enzymes for every active enzyme.
Biology
1 answer:
olya-2409 [2.1K]3 years ago
7 0

Answer:

The correct option is 3. "At pH 6.5 the enyzme is 50% active"

Explanation:

For the titratable group to be protonated and cause the enzyme to be in the active state, it needs to have gained a hydrogen cation (H+). In order for that to happen, there must be enough hydrogen cations in the environment of the enzyme, and hence, an acidic pH is required in this case.

You might be interested in
Which gland controls formation of male body features
Serggg [28]

The gland that controls formation would be testes.

6 0
3 years ago
Read 2 more answers
Describe how the kidney and bladder work together to remove waste from the body (y'all I understand nothing about biology)
riadik2000 [5.3K]
The kidneys remove any waste that is not needed in ur body then ur bladder lets all the waste out
3 0
2 years ago
30. ) Most organisms grow by ______.
schepotkina [342]
(C) the cell cycle is important and cell division divides the cell.
8 0
2 years ago
Which organism is an example of an organism that is an active filter feeder?
Reika [66]

d. Sea Cucumber

Sea cucumbers are filter feeder. Sea cucumbers often find places that have strong currents to find food.

7 0
2 years ago
Read 2 more answers
Which of the following animals give direct birth to babies?
UNO [17]

Answer:

Whale

Explanation:

Blue Whale, a bat has its things with another bat, a snake lays eggs.

4 0
2 years ago
Read 2 more answers
Other questions:
  • What leads to the formation of a windchill factor?
    6·2 answers
  • Which term should the nurse use to describe a scar that extends beyond the border of traumatized skin?
    12·1 answer
  • Where are the four macromolecules located in all living things?
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which of the following is caused by bad genes? *
    14·1 answer
  • Which part of a lake is most likely to have no photosynthesis?
    14·2 answers
  • Kudzu, a plant native to eastern Asia was introduced into America in 1876. In 1935, kudzu was planted along southern roadways to
    9·1 answer
  • which star is the closest to the earth? how long does it take for light to travel from this star to earth
    12·1 answer
  • Based on Redi’s experiment shown in the image, how many jars of meat were used to test his hypothesis?
    12·2 answers
  • Which of the amino acids could form a hydrogen bond with another amino acid in the chain?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!