1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena L [17]
3 years ago
14

How is homeostasis important to the survival of organisms ​

Biology
1 answer:
attashe74 [19]3 years ago
5 0

Answer:

Homeostasis is the ability to maintain a constant internal environment in response to environmental changes so organism must need it so they can be balanced internally in response to the environment .

Hope This Helps!  Have A Nice Day!!

You might be interested in
How are monomers and polymers related? *
BigorU [14]

Explanation:

Monomers are small molecules, mostly organic, that can join with other similar molecules to form very large molecules, or polymers. Polymers are chains with an unspecified number of monomeric units. a polymer. Homopolymers are polymers made by joining together monomers of the same chemical composition or structure.

6 0
3 years ago
Need this ASAP. 20 points
SVEN [57.7K]
The answer will be B
8 0
3 years ago
Read 2 more answers
Function of epiglottis​
Butoxors [25]

Answer:

prevents secretion of upper air passage

Explanation:

to prevent foods and drinks from falling down the airway which is called aspiration and may lead to pneumonia

7 0
3 years ago
(2pts) While doing this experiment, it will be important to keep everything on ice. Why is it important to keep everything cold?
mart [117]

Answer:

Temperature is an essential aspect in any experiment as it can affect the various variables of the experiment. It can affect the result and outcomes of an experiment as per the interaction various molecules shows with the temperature.

In molecular biology related experiments that deals with the protein related experiments are also effected by the temperature as enzymatic reactions are slow on low temperature and proteins are also act like enzymes. On high temperature protein may lead to increase in collisions of the molecules of protein and fasten the enzymatic reaction and may lead to degrade the protein.

3 0
4 years ago
Which statement accurately compares archaebacteria and eubacteria?
Readme [11.4K]

Answer:

maybe

Explanation: both idk for sure sry i tried

3 0
3 years ago
Other questions:
  • When you begin exercising regularly, what happens to the blood vessels in his muscles?
    13·1 answer
  • Which statement is incorrect about natural selection?​
    13·2 answers
  • In open areas and around vessel swim platforms, certain activities should be avoided. what activity should be avoided in order t
    14·1 answer
  • Explain the domain.How has it changed over the years?
    8·1 answer
  • All countries require the labelling of GMO's on food being sold.<br><br> true<br><br> false
    9·2 answers
  • An organism grew well on TSA plates, a bit slower on MM1 and not at all on MM1 without glucose. The results indicate that organi
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Descibe how the muscle contracts and recharges starting with the release of Ca+ and ending with the cycle of recharging
    6·1 answer
  • **NO LINKS** Biomass pyramids &lt;3
    15·1 answer
  • Drag each label to the correct location on the diagram.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!