1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lubov Fominskaja [6]
3 years ago
11

How would smoke or pollution affect the process of getting oxygen into your eyes?

Biology
1 answer:
xz_007 [3.2K]3 years ago
3 0
If you have all this smoke and stuff covering your eyes it makes it harder to make things get there that one reason your eyes water too
You might be interested in
What type of protein stays only on the surface of the plasma membrane
nevsk [136]

Your answer is the peripheral proteins. Its on the inner or outer surface of the phospholipid bilayer, but not embedded in its hydrophobic core.

4 0
3 years ago
Read 2 more answers
What does it mean when they say genetic.
olya-2409 [2.1K]

Answer:

relating to or determined by the origin, development, or causal antecedents of something

Explanation:

3 0
3 years ago
Read 2 more answers
WHy is water important to life?
Radda [10]

Answer:

At heart, all life on Earth uses a membrane that separates the organism from its environment. ... In this regard, water is essential simply because it's a liquid at Earth-like temperatures. Because it flows, water provides an efficient way to transfer substances from a cell to the cell's environment.

8 0
3 years ago
Describe the relationship<br> between variations and<br> adaptations?
laila [671]
Adaptations are physical or behavioral traits that make an organism better suited to its environment. Heritable variation comes from random mutations. Random mutations are the initial cause of new heritable traits. For example, a rabbit can't choose to have a different fur color.
mark brainlist plsss
3 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • All material objects constructed by humans or near-humans revealed by archaeology are considered part of the
    7·1 answer
  • Does anyone have any science topic ideas?
    10·1 answer
  • 90%
    9·2 answers
  • Identify three structures which provide support and protection in a eukaryotic cell.
    12·2 answers
  • I need help in anatomy physiology
    6·1 answer
  • What does the process of absolute dating determine?
    7·2 answers
  • The study of the changes in form that occur between conception and physical maturity is called
    6·1 answer
  • Do prokaryote And eukaryotes and viruses have liquid cytoplasm
    11·1 answer
  • In glycolysis ,the glucose molecule is break down to?
    13·2 answers
  • Consider, pea plants, for which green color is dominant to yellow color, and two leaves are dominant to three. A cross between t
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!