1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tema [17]
3 years ago
5

Shortest time period in the life cycle of a cell?

Biology
2 answers:
IRINA_888 [86]3 years ago
5 0

Answer:

c

Explanation:

Effectus [21]3 years ago
4 0

Answer:

Mitosis

Explanation:

Most of the time, our cells are in interphase and G1 and G2

You might be interested in
In the term trace element, the adjective trace means that
Margarita [4]

Answer:

The elemental is required in very small amount. (Ans. A)

Explanation:

Trace element is also known as micro-nutrient. It is also defined as any chemical element required by living organisms in a minute or small amounts which is usually part of the vital enzyme (cells produced by catalytic protein).

Exact needs of trace elements vary among species, like commonly required plant trace elements are cooper, zinc, manganese, boron, and molybdenum. Animals commonly required iodine, manganese, and cobalt.

Absence of necessary plant trace elements required by plants in the soil causes deficiency disease, lack of animal trace elements used by animals in the soil may not harm plants, but, animals feeding on those plants develop their deficiency disease.

So, the adjective trace means that the elemental is required in a very small amount.

7 0
3 years ago
Which condition causes fatty substances to build up in blood vessels?
serious [3.7K]
Atherosclerosis is a condition that occurs when fatty substances (plaque) build up in blood vessels. The accumulation of the fatty substances can cause partial or complete blockage of blood flow through an artery. Symptoms of this condition include a mini-stroke, pain in the chest <span>and pain in the leg muscles during exercise.</span>




3 0
3 years ago
Read 2 more answers
Drosophila may be trisomic for chromosome IV and remain fertile. The gene determining the shape of bristles is in chromosome IV.
aev [14]

Answer:

I am going to give you the material so that you can be your doubt but I will not solve it because that is the basis of your learning that you react to what you are reading

In Mendel's "Experiment 1", pea plants with smooth seeds intersect with pea plants with rough seeds. (smooth seeds is the dominant feature). Mendel collected the seeds of this cross, the plants and obtained the F1-generation of plants, let them self-pollinate to form a second generation, and analyzed the seeds of the F2 generation. The results they obtained; And the ones you would predict in this experiment are:

Guide

F1-generation plants

Mendel crossed SS (smooth seeds) with ss (rough seeds.)

All the gametes of parents smooth seeds, have the allele S (dominant) and all the gametes of parents rough seeds have the allele s (recessive). All the plants of the F1 generation will affect the Ss genotype (heterozygous), and all the seeds smooth seeds.

Generation-F2 plants

Mendel let the F1-generation plants self-pollinate to form a second generation and analyzed the seeds of the resulting F2 generation.

F2 generation    

All F1 hybrid plants have the Ss genotype and all are smooth (dominant characteristic). Recessive alleles are secreted during gamete formation. As a result, one in four possible combinations in F2 generation plants will have the recessive homozygous genotype (ss).

4 0
3 years ago
Where is a codon found
ICE Princess25 [194]

Answer:

A codon is found on the coding strand of double-stranded DNA and in the (single-stranded) mRNA. The anticodon is found on the tRNA and is the part that base-pairs with the codon (on the mRNA) in order to bring the appropriate amino acid to the ribosome to be added to the growing peptide chain.

4 0
2 years ago
Most water-soluble hormones exert their effects through the second messenger cyclic AMP (cAMP). This activity will test your und
Viktor [21]

Answer:

cAMP dependent pathway is important for processing of life.

Explanation:

cAMP pathway is also called as adenynyl cyclase pathway.

This mechanism requires different steps like-

  1. G protein coupled receptor is a integral protein that is activated by different external stimuli which binds with the specific ligand.
  2. Extracellular ligand causes activation of GPCR which in turn is responsible for conformational change  in the receptor and allows it to bind with the intracellular heterotrimeric G protein complex.
  3. The Gα  stimulate G protein complex to exchange GDP for GTP and then the complex is released.
  4. Activated Gα binds with adenylate cyclase and catalyzes ATP to form cyclic AMP.
  5. Activation of cAMP leads to the activation of nucleotide gated ion channel, and PKa(Protein kinase A) which is also called as cAMP dependent enzyme.
  6. Once, PKA is activated,it causes phospholylation of other proteins like AMPA receptor,transcription factors which regulate gene expression, and convert glycogen into glucose.
8 0
3 years ago
Other questions:
  • Critical Thinking: Describe a food chain that ends with a bird.
    8·2 answers
  • Question 4
    8·2 answers
  • Which of the following describes a rapidly expanding population?
    10·2 answers
  • Site-directed mutagenesis is a method in biochemistry/ molecular biology that introduces small changes into the DNA sequence of
    7·1 answer
  • Explain what it means to say that natural selection is not random
    10·1 answer
  • Which process does not occur in mitosis and why is this important?
    13·1 answer
  • A section of our DNA that codes for a specific trait is called a....
    5·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Your friend claims that all mutations are harmful to living things. Do you agree or disagree with this claim?
    7·1 answer
  • The atmosphere of Earth today primarily contains the following gases: carbon dioxide (CO2), water vapor (H2O), nitrogen (N2), an
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!