1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xxMikexx [17]
2 years ago
6

What can lead to coral bleaching?

Biology
2 answers:
IgorLugansk [536]2 years ago
7 0
 Long term temperature variations, increased solar radiation,and Freshwater dilution 
diamong [38]2 years ago
4 0

Increased Sunlight is the correct answer -Apex


You might be interested in
A population of wolves predates a population of moose on Isle Royale, Michigan, where there are fewer wolves than moose to start
andrew11 [14]

Complete question:

A population of wolves predates a population of moose on Isle Royale, Michigan, where there are fewer wolves than moose to start. The wolves prey on the moose and eat well, allowing them to have abundant offspring. However, as the wolf population rises, the moose population drops, and over time, the wolf population begins to drop also because of the reduced availability of resources. As the wolf population drops, moose are able to better survive and reproduce, causing the moose population to rise. With this abundance of moose, the wolf population is able to rebound until their population exceeds the moose population’s ability to support the number of wolves. Which population dynamic does this series of oscillations represent?

  1. Delayed density dependence
  2. Delayed density independence
  3. Extinction vortex
  4. Carrying capacity

Answer:

  1. Delayed density dependence

Explanation:

The Delayed density dependence occurs when two species are in interaction (prey-predator or parasite-host), and the dynamic of each population follows the dynamic of the other population. The natality and mortality rates of one species follow the rates of the other species.

<em>Delayed density dependence dynamics regulate populations and allow the occurrence of equilibrium or balance in nature.</em>

<u>Predator-prey scenarios</u>

Assuming that the prey lives in the ideal environment with no predators, it shows an exponential growth rate. Prey can grow, develop, and reproduce, increasing its population size. The more available items, the more predator there will be. The predator population increase in size, and its presence affects the prey populations, leading it to decrease. So there are fewer available items to prey on.    

The prey population also affects the predator population. After the increase in the predator population size, the number of available prey decreases. The predator lives in an ideal environment but depends on the prey density. The more predators there are, the fewer prey there will be left. The predator population decreases exponentially due to the item's lack. The predation rate depends on density as well as natality and mortality rates.

So, to sum up,

  1. prey population increases in size
  2. predator population increases in size
  3. prey population decreases in size
  4. predator population decreases in size

In this particular example, the wolves population follows the moose population and vice-versa. It is not simultaneous. It happens with a delay.

<em>Moose influences the wolf population because they are their source of food. The more moose, the more wolves there are. The fewer moose, the fewer wolves there are. </em>

This is a density-dependent dynamic because both populations are affected when they reach a high value.

6 0
3 years ago
Confused please help thanks
miskamm [114]

i think it is r next

8 0
2 years ago
If the liver cells of an animal have 24 chromosomes, its sperm cells would have how many chromosomes?
MAVERICK [17]
<span>If the liver cells of an animal have twenty-four chromosomes, the same animal would have twelve chromosomes in its sperm cells. Chromosomes are paired into two types, the X and Y components. The Y components are the sperm cells of an animal.</span>
4 0
3 years ago
What are two example of thermal energy in the real world? Thanks in advance
Shalnov [3]

HOPE THIS works

Explanation:

Boiling water on a stove is an example of thermal energy. Thermal energy is produced when the atoms and molecules in a substance vibrate faster due to a rise in temperature.

6 0
2 years ago
Which best describes the difference between osmosis and diffusion
Nana76 [90]
Well Osmosis is a process by which molecules of a solvent tend to pass through a semipermeable membrane from a less concentrated solution into a more concentrated one, thus equalizing the concentrations on each side of the membrane. And Diffusion<span> is the net passive movement of particles (atoms, ions or molecules) from a region in which they are in higher concentration to regions of lower concentration.</span>
3 0
2 years ago
Read 2 more answers
Other questions:
  • The chemical stockroom also contains a solution labeled unknown. This solution contains a 0.10M solution of a "synthetic base".
    13·1 answer
  • An atom that gains or loses electrons is called
    9·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Explain how an atom becomes an ion.
    12·1 answer
  • An example of mitosis at work is a plant root
    15·2 answers
  • What is the function of the respiratory zone?
    14·1 answer
  • Puberty is initiated when the hypothalamus significantly increases secretion of
    8·1 answer
  • Compare and contrast prokaryotic and eukaryotic cells in terms of genetic material
    11·1 answer
  • What are centrioles?
    15·1 answer
  • A student made the following table comparing the support structures in animals: Examples of Support Structures in Animals Exoske
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!