1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liberstina [14]
3 years ago
8

A pitcher throws the ball, it will travel at 10 meters per second. How long will it take for the ball to reach the hitter. The p

itcher is 20 meters away
Biology
1 answer:
Furkat [3]3 years ago
8 0

Answer:

2 sec

Explanation

travel speed is = 10 m/sec

so for 20 meter = 20/10 = 2 sec

You might be interested in
Please in need of help
Rzqust [24]

Answer:

the answer is C i know it

Explanation:

i expect brainliest

5 0
3 years ago
Read 2 more answers
If a smoker has a low tidal volume why might he feel tired and run down
OLEGan [10]

oxygen flow is low and his lungs do not have a lot of capacity

4 0
3 years ago
Read 2 more answers
Plz idk if it’s correct
kap26 [50]

Answer:

Yes you are correct.

Explanation:

Number one is the rough ER not the nucleus. Number 3 is the mitochondria not the Ribosomes. This is an animal cell so there can not be a cell wall. There are exactly 3 small vacuoles in an animal cell so yes, you are correct.

3 0
3 years ago
Read 2 more answers
28. Which statement best explains why cellular respiration in plants and
bazaltina [42]

Answer: Photosynthesis provides the materials that fuel cellular respiration.

Explanation:

Photosynthesis, the process through which green plants convert light to chemical energy. The energy that is gotten from sunlight by green plants, some protistans, and bacteria is used to produce sugar which is then converted to ATP by cellular respiration which is regarded to as the fuel that living things use.

Therefore, the statement that best explains why cellular respiration in plants and other organisms is dependent on photosynthesis is that photosynthesis provides the materials that fuel cellular respiration.

8 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • A client with a diagnosis of polyarteritis nodosa asks the nurse for information about this disorder. what information should th
    5·1 answer
  • I can't figure out the answer
    14·1 answer
  • Which of these can be found in a plant cell but not in an animal cell?
    11·1 answer
  • What type of molecule is fat?
    5·2 answers
  • One cat carries heterozygous, long-haired traits (Ss), and its mate carries homozygous short-haired traits (ss). Use a Punnett s
    14·1 answer
  • Mold, a form of fungi, reproduces
    7·2 answers
  • a cell was poisoned by a substance that destroyed all of its mitochondria. which cell transport processes would be able to still
    9·1 answer
  • Which Antimicrobial agent had the highest zone of inhibition for on Streptococcus pneumoniae
    6·1 answer
  • What happens to air that causes high-pressure systems?
    14·1 answer
  • Which one of the following conditions would allow gene frequencies to change by chance? small populations gene flow large popula
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!