1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SVEN [57.7K]
3 years ago
11

The DNA is mostly _____ because the hyperchromic effect is very _____. The fact that there is any hyperchromicity at all means t

hat there may be a _____ amount of intramolecular base-pairing.a. greatb. largec. double-strandedd. smalle. single-stranded
Biology
2 answers:
maria [59]3 years ago
6 0

Answer:1.c 2.d 3. d

Explanation:

The DNA hyperchromic effect can be defined as the absorbance of radiation or light by the nitrogen bases of DNA. This phenomena is effective when the DNA is in single stranded condition. For observing the hyperchormic effect the DNA is required to be denatured at high temperature or by increasing the level of pH.

The two strands of the DNA when get separated the absorbance of the DNA solution also increases. This results due to reduction in the base-base interaction and hence, increases the absorbance of light like UV by the bases.

FromTheMoon [43]3 years ago
6 0

Answer: Option C,D and D.

1. C 2.D.3.D

Explanation:

DNA, deoxyribonucleid acid is the genetic material or component of living organisms . It has two two chains that coil around each other to form double helix structure. It is found in the nucleus because it is small and the cell itself is small.DNA have two base pairs and carries genetic information for growth, reproduction, functioning and development.

The DNA is double stranded, the hyperchromic(,its ability to absorb light)effect is small, and there are small amount of molecular base pairing. The hyperchromic effect of DNA is the ability of DNA to absorb light at night temperature. The double stranded DNA is heated at high temperature,and it unwind to single stranded DNA which have the ability to absorb light.

You might be interested in
Which of the following is the most important, publicly available, health science database?
Dovator [93]

Answer: 4.

This is a free search engine maintained by the United States National Library of Medicine.

It is used for accessimg and searching of MEDILINE database.

Medline is an acronym for (Medical Literature Analysis and Retrieval System Online) it is conprehensive bibilography of research materials in fields of biomedicine and life sciences.It contains abstracts and references of related journals.

It is an online repository for biomedical research materials

It also helps to promotes the concept of evidence based medicine.(The concept of clincal medicine that depends on the combination of available research evidences with patients values and clincal research.)

Therefore the use of Pubmed is to gain access into all the information above in the MEDLINE.

3 0
3 years ago
Need it now 100 points
Phoenix [80]

Answer:

I think the answer is D

Explanation:

8 0
2 years ago
Read 2 more answers
Not multiple choice.The function of the larger, more typical pinecone is:
ddd [48]
To produce eggs.

The large pinecones we typically see are female cones which house the eggs and then becomes a seed. The little cones that we don’t really notice are male cones
3 0
3 years ago
Read 2 more answers
Why is wind erosion so harmful?
grigory [225]
The answer to your question is it removes the most fertile part of soil
7 0
3 years ago
Read 2 more answers
Choose the letter that indicates the organelle that contains most of a cell's dna.
BabaBlast [244]
The part of the cell that contains most of its dna is the nucleus
3 0
3 years ago
Other questions:
  • Please help and fast and no GUESSING or i'll report you.
    10·2 answers
  • Life is organized in a hierarchical fashion. Which of the following sequences correctly lists the levels of life from simple to
    7·1 answer
  • The practice where advanced learners are separated from regular learners is referred to as:
    5·2 answers
  • Uppose that you are studying an inducible operon that contains two genes required for the metabolism of compound xyz. gene a enc
    8·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Que es el nivel celular
    15·2 answers
  • How many fundamental forces exist in nature?<br> two<br> three<br> four<br> five
    6·2 answers
  • What is "crossing over" ?
    6·1 answer
  • The _____________ receives blood from the atrium and pumps it out of the heart.
    15·1 answer
  • On June 22, how much daylight is received by locations in the Arctic Circle?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!