1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
3 years ago
6

If, on average, 46% of the loci in a species' gene pool are heterozygous, then the average homozygosity of the species should be

:__________.
A) 23%B) 46%C) 54%D) 92%

Biology
1 answer:
tino4ka555 [31]3 years ago
3 0
A of course :) because there are not many species

You might be interested in
In what part of the cell does protein synthesis occur
Softa [21]
It occurs in the ribosomes.
6 0
3 years ago
Why is the resting membrane potential (Vm) approximately - 70 mV for most cells? Most cells contain a large concentration of Cl-
Yuki888 [10]

Answer:

Option (4).

Explanation:

Cell membrane potential may be defined as the difference in the electric potential between inside and outside of the cell. This potential is important for the action potential.

The resting membrane potential of the cell is -70mV. This membrane potential is maintained by the potassium ions of the cell. The cell membrane are almost 40 times more permeable to potassium ions than sodium ions and makes the cell membrane potential negative.

Thus, the correct answer is option (4).

7 0
3 years ago
Women who take fertility drugs to assist in becoming pregnant have increased chances of giving birth to
Nata [24]

The correct answer is option (d) that is dizygotic twins.

The dizygotic twins also known as non-identical twins or fraternal twins, that is, two siblings who come from distinct eggs or ova, which are discharged at the similar time from an ovary and are fertilized by different sperm.

4 0
3 years ago
Type of response in which physical reactions result from stress
Serjik [45]
The answer is  Chronic<span> Stress</span>
8 0
3 years ago
The most recent major ice age in North America extended as far south as _____.
pishuonlain [190]

Answer:

Nebraska and Iowa.

4 0
3 years ago
Other questions:
  • How man tails does an octopus have?
    10·2 answers
  • Mary Shelley traveled to Switzerland so that she could find a quiet place to write her novel.
    10·1 answer
  • A person is found dead by a neighbor.What career is involved in notifying the police and calling an ambulance
    5·1 answer
  • Which best describes a centromere?
    8·1 answer
  • What does this joke mean? ​
    12·2 answers
  • Algae are green plants.
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Drag the appropriate descriptions of the subatomic particles into the following boxes. Labels may be used more than once.
    11·1 answer
  • 16. Which of the following causes the brain to stimulate faster breathing?
    14·1 answer
  • What may be the ways for disaster management? clarify.​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!