1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
11Alexandr11 [23.1K]
3 years ago
10

Which characteristics do cell membranes and cell walls have in common?

Biology
1 answer:
earnstyle [38]3 years ago
5 0
<span>Both protexts the organisms' organelles which are inside the cell.
Animal Cell: Cell Membrane
Plant Cell: Cell Wall
Cell wall is present only in plants, it is not found in all organisms. Compared to the cell membrane, a cell wall is thick and has a rigid structure. You can see it in a light microscope, because it is visible. It serves as the protective cover that surrounds the plasma membrane in a plant cell. Cell membrane is composed of lipids. Cell walls can be made up of cellulose or peptidoglycan or chitin.<span> </span></span>
You might be interested in
True or false question Because they are more complex, many-called organisms cannot reproduce asexually
Artist 52 [7]
That is completely false...

7 0
3 years ago
The population in South Africa is more prone to sickle cell anemia (genotype "ss"). People with genotype "ss" survive only up to
lions [1.4K]
The answer is stabilizing selection.

<span>Sickle-cell anemia is a recessive disorder caused by the presence of two recessive alleles "s", so genotype is "ss". This disorder is characterized by sickle hemoglobin. In an area with malaria, heterozygous individuals "Ss" (with one dominant allele and one recessive allele) have an advantage. These individuals will have both normal and sickle hemoglobin. But pathogen that causes malaria affect only normal hemoglobin, so heterozygous individuals will have half of the hemoglobin resistant to the pathogen and those individuals are resistant to malaria.</span>

Stabilizing selection favors heterozygotes Ss,  disruptive selection favors dominant (SS) and recessive (ss) homozygotes, while directional selection favors dominant (SS) or recessive (ss) homozygote. Since in this example, people with genotype Ss (heterozygotes) are in advantage, then this is an example of stabilizing selection.

7 0
3 years ago
Rays of the sun hitting your face. is it potential energy kinetic energy or both
kiruha [24]

Answer:Radiant energy is a form of kinetic energy so it is Kinetic energy .

8 0
2 years ago
20 POINTS
charle [14.2K]
Cell wall - Adds structural support to the cell. Holds the cells together
Cell membrane - Serves as a barrier to the cell and allows more nutrient and molecules to move in and out of the cell without letting things that can harm the cell in. 
Outer membrane - Serves the same basic functions a the cell membrane. (Depending on how complicated the class your in is, I would visit this website for more information... https://en.wikipedia.org/wiki/Bacterial_outer_membrane )
Pili - Help the cell move and attach the bacteria to surfaces are other cells. 
DNA - Contains the genetic instructions on what the cell can physically do, operate, and reproduce. 
Flagellum - Helps the cell move. It kind of acts like a propeller for the cell so that it can move around. 
8 0
3 years ago
A niche is part of an organism's habitat.<br><br>TRUE or FALSE
NikAS [45]

Answer:

True

Explanation:

Hope this helps!

8 0
3 years ago
Other questions:
  • Which term describes the simplest method of performing chant?
    15·2 answers
  • Peptidoglycan is the material found in the bacterial that forms a molecular basis of the Gram stain.
    6·2 answers
  • PLEASE HELP I WILL GIVE YOU ALOT OF POINTS<br> How are infectious agents transmitted?
    13·2 answers
  • The thin segment of the nephron loop's descending limb ________.
    14·1 answer
  • A cat weighs 8.5 pounds on earth. how much would this cat weigh on neptune?
    9·1 answer
  • Beny mendorong kereta belanja dengan gaya sebesar 250 N
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • If you need help friend me 4th-7th grade
    10·1 answer
  • Ill give you a brainliest if it is right
    14·1 answer
  • A scientist is examining a single-celled organism that is often found in the human body; some examples of this organism are help
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!