1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitry [639]
2 years ago
12

What are two largest greenhouse gases ? Where does each come from ?

Biology
1 answer:
sp2606 [1]2 years ago
5 0

Answer:

Carbon Dioxide - Comes from fossil fuels

Methane - Comes from agriculture and waste

Explanation:

You might be interested in
The cycads, a mostly tropical phylum of gymnosperms, evolved about 300 million years ago and were dominant forms during the age
ozzi

Answer:

poliinators and flagellated sperm

Explanation:

Cycads (phylum Cycadophyta) together with Ginkgophyta, Gnetophyta, Pinophyta, Pteridospermales and Cordaitales  belong to the gymnosperms (naked seed-producing plants). They are different than angiosperms which produce encased seeds within an ovary.

Cycads (but also Ginkgo) produce swimming sperm that is different than all other groups which produce sperm without swimming flagella.

Also, unlike other groups of gymnosperms, cycads have specialized  pollinators, beetls.

6 0
3 years ago
What amino acid property makes proteins highly functional
sasho [114]

Answer:

The correct answer would be - structure of protein and conformation of the R group of the particular amino acid.

Explanation:

The functional properties such as solubility, color, water retention and absorption, texture, foam formation, curdling and other are decided and depends on the structure of the protein and make up of the R-group attached to particular amino acid.

Each amino acid has a single conformation different from other amino acid and which is extremely stable, this unique conformation has its chemical properties that helps in proteins to perform certain and particular catalytic and structural function.

Thus, the correct answer is - structure of protein and conformation of the R group of the particular amino acid.

5 0
3 years ago
A. Producer<br> B. Primary consumer<br> C. Secondary consumer<br> D. Tertiary consumer
Veseljchak [2.6K]

Answer:B. Primary consumer

Explanation:The reason why Its b because that primary comsumers are mostly herbivores or the primary comsumer is the first consumer to eat the producer.Hope it helps!

3 0
2 years ago
All cells are surrounded by a cell membrane. Which statement is NOT an accurate description of a cell membrane? a Regulates what
Novosadov [1.4K]

Answer:

The correct answer is -  b. Responsible for the formation of ATP

Explanation:

The cell membrane is the outer membrane of all types of the cell including eukaryotic, and prokaryotic cell. The cell membrane surrounds the cytoplasm and cell organelles.

The cell membrane is made up of phospholipids that have a hydrophilic and hydrophobic region in the lipid bilayer. The main function of the cell membrane is to protect the cell, provide support, and regulation what enters and leaves the cell. ATP formation is not produced by the cell membrane.

4 0
2 years ago
Enzymatic breakdown of which of the following compounds doesn’t begin until it reaches the stomach?
ahrayia [7]

Answer:

B. Proteins

Explanation:

Salivary amylase is an enzyme that starts the breakdown of starch in the mouth. Gastric glands of the stomach secrete gastric juice, which contains HCl to kill bacteria and denatures proteins, intrinsic factors, and the enzyme pepsin. The chief cells of gastric glands secrete pepsinogen (an inactive form of pepsin).

Pepsin begins the digestion of proteins in the stomach. It breaks down certain peptide bonds between amino acids and thereby, breaks down protein chain into smaller peptide fragments. Pepsin requires a very acidic environment of the stomach (pH 2) and becomes inactive at a higher pH.

5 0
3 years ago
Other questions:
  • What is one effect of a fever?
    15·1 answer
  • What are the four carbon macromolecules the body uses and makes?
    14·1 answer
  • ANSWER PLS: WILL GIVE BRAINLIEST
    14·1 answer
  • Write the three major types of fungi and an example of each.
    12·1 answer
  • Scientists were able to determine the age of the earth from rock samples that were analyzed. What technique was used to do this
    5·1 answer
  • Genetics Problems (ABO Blood System) The chart below lists the blood phenotypes of 8 individuals. Use the information in the cha
    11·1 answer
  • How much force is needed to make a 12 kg object accelerate at 3 m/s
    14·1 answer
  • During DNA replication, two extra guanine bases are added to the DNA. What type of mutation is this?
    11·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Certain substances, like caffeine and citrus juices, are classified as diuretics. This means that they cause diuresis in the kid
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!