1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wel
3 years ago
12

The secretions of the adrenal medulla act to supplement the effects of ________.

Biology
1 answer:
Nutka1998 [239]3 years ago
7 0

Answer:

sympathetic stimulation

Explanation:

Under stress or emergency conditions, the preganglionic neurons of the sympathetic division release acetylcholine. Acetylcholine stimulates secretion and release of epinephrine and norepinephrine from the adrenal medulla. These hormones enhance the effects of the sympathetic division of the autonomic nervous system (ANS) during stress. Epinephrine and norepinephrine augment the fight-or-flight response as they increase the heart rate and force of contraction, the output of the heart, and blood pressure. They also increase blood supply to the heart, liver, and adipose tissue. The airways to lungs become dilated and there are increase blood levels of glucose and fatty acids.

You might be interested in
DNA in the nucleus carries the genetic code for making proteins in ribosomes. The diagram shows a model of DNA. Which part of th
katovenus [111]
The answer is D
The nitrogen bases adenine, thymine, cytosine and guanine code for the amino acid sequence in the protein
3 0
3 years ago
Read 2 more answers
In watermelons, solid green rind color (G) is dominant to stripes (g).
stiks02 [169]

There are chances of 75% solid green coloured rind in watermelons.

Explanation:

Dominant trait = Solid Green rind G

Recessive trait= stripes g

Given that both the parent plants are heterozygous so their alleles will be

Gg Gg

From the Punnet square

          G        g

G      GG     Gg

g       Gg     gg

The phenotype ratio is 3:1  ( 3 watermelons with the green colour rind and 1 with striped rind observed)

Genotype ratio is 1:2:1

From the observation, we can say that 75% of the watermelons will have solid green colour rind because G is dominant over g.

6 0
3 years ago
Aiden is a 4 month old baby boy. when he was born his mother decided to breast feed him, instead of using formula. what type of
Alex73 [517]
<span>Actually baby Aiden will surely develop a strong secretory Iga antibodies which is passive immunity to most of the types of bacteria and viruses, ie, as a protection against infections, which inturn is a response to the baby to its immune system in the form active immunity.</span>
7 0
3 years ago
Read 2 more answers
What substances make up carbohydrates what characteristics do carbohydrates have?
Wittaler [7]
They can also use carbohydrates so I don't know
3 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • which of the following provides the best analogy for an electron in an atomic orbital? a. a bee moving from flower to flower in
    11·1 answer
  • In sigmund freud's theory, the _______ operates according to the pleasure principle. (1 point)
    14·1 answer
  • Why is something like a cold, a condition that obviously affects homeostasis, not considered a disease?
    10·1 answer
  • Plants can grow successfully in soil that is considered sub-par if they have
    14·1 answer
  • A team of researchers calculates that a glacier will melt completely away in the next 100 years. Which land structure will most
    7·1 answer
  • Are polar bodies formed from spermatogensis
    11·1 answer
  • Which of the following would differ if you compared the same reaction taking place with and without enzyme?
    5·1 answer
  • Samuel is interested in taking a vitamin supplement. about what percentage of u.s. adults regularly take a vitamin-mineral suppl
    10·1 answer
  • According to the modem theory of evolution, closely related species of organisms share:
    7·1 answer
  • What term describes the blood<br> pressure when the heart is<br> contracting?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!