Isotopes
The answer has to be 20 characters long so this is irrelevant.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Differences in temperature or precipitation determine the types of plants that grow in a given area (Figure 1). Generally speaking, height, density, and species diversity decreases from warm, wet climates to cool, dry climates. Raunkiaer (1934) classified plant life forms based on traits that varied with climate.
Explanation:
Yes. With the help of every individual organelle in the cell's body, a cell can keep itself alive. For example, they can use cellular respiration to create ATP.
Answer:
The monitoring the growth rate of E.Coli bacteria is a useful indicator of the effect of glycotic enzyme mutation on the bacteria as the flow of intracellular metabolic components depends on the availability of carbon. Hence the change in carbon source can change the glyclyotic enzyme mutation up or down.
Explanation:
Continuous culture is a method that can be used by the researchers for determining whether mutation affects the growth rate of E.Colin-M bacteria
If the growth medium contains higher concentration of acetate,then the growth of the bacteria will be inhibited without inhibiting its central metabolism.
When E.Coli grows ,it secrets acetate. This mechanism is called overflow mechanism. Regulatory interactions mediated by acetyl-phosphate plays a major role in inhibiting growth by acetate. The uncoupling effect of organic acids or perturbation of the anion composition of the cell is a major reason for growth inhibition.
