1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiv31 [10]
3 years ago
13

During which stage of mitosis do the chromosomes attach to the spindle fibers and line up in the center of the cell

Biology
1 answer:
Naya [18.7K]3 years ago
6 0

Answer:

The answer is

Explanation:

Metaphase

You might be interested in
What is released at each level of a pyramid of energy
Finger [1]
I think it is heat!!!!
3 0
3 years ago
Short notes on dispersal of seed
Alenkasestr [34]

Explanation:

<u>Seed Dispersal is an adaptive mechanism in all seed-bearing plants, participating in the movement or transport of seeds away from their parent plant to ensure the germination and survival of some of the seeds to adult plants. There are many vectors to transport the seed from one place to another.</u>

<u>\huge\mathbb\colorbox{black}{\color{lime}{AnSwEr by ਪ੍ਰੀਤ ❣}}</u>

5 0
2 years ago
Read 2 more answers
What percent of the offspring will be red, if we cross two pink tulips?
tresset_1 [31]

Answer:

50%

Explanation:

7 0
3 years ago
Read 2 more answers
Why is it important that cells contain catalase?
Triss [41]
<span>Catalase catalyzes the decomposition of hydrogen peroxide to water and oxygen. It is a very </span>important<span> enzyme in protecting the </span>cell<span> from oxidative damage by reactive oxygen species. Hope this answers the question. Have a nice day.</span>
7 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Other questions:
  • Is energy in fossil fuels is derived from the energy stored in plants and animal matter?
    5·1 answer
  • The _______ is the smooth, triangular surface where the anterior surface of the scapula faces the ribs.
    14·1 answer
  • The genetic molecule common to all living things is
    5·1 answer
  • Why are organelles important to plants
    6·2 answers
  • What is the function of lateral meristem
    11·1 answer
  • Think about a bush in your back yard. Is it alive according to the characteristics of life? Why or why not?​
    9·1 answer
  • The hypothalamus, which is involved in maintaining steadiness of bodily functions, the hippocampus, which is involved in memory,
    10·1 answer
  • Please read the following scenario to answer the following questions.
    9·1 answer
  • Are any bacteria made of more than one cell?
    9·2 answers
  • Hey y'all I just really need help with this question so if y'all didn't mind and try to help me that would be greatHELP ME PLEAS
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!