1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lubasha [3.4K]
4 years ago
13

please submit 10 possible test questions with answers that may be used to help generate a final exam for biology​

Biology
2 answers:
ehidna [41]4 years ago
6 0
What is mutualism, how can you describe it?
IRISSAK [1]4 years ago
5 0

Answer:

what is biology

what does biology mean

You might be interested in
Which trophic level contains the most energy?
Dmitriy789 [7]
B hope this helped ..... !!!!
5 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Which sensory system(s) have receptors which die after awhile because it/they have direct exposure to the environment?\?
Anika [276]
The OLFACTORY AND THE GUSTATORY SYSTEMS have receptors which die out after sometimes because of direct exposure to the environment.
The olfactory system has to do with the perception of smell while the gustatory system has to do with taste stimuli. For these two basic sense organs, their perception rate is always highest when they are newly exposed to a stimuli, after continuous exposure to the stimuli their receptors die out.

7 0
4 years ago
Multiple Choice
Anvisha [2.4K]

Answer:

1:Mosquito

Explanation:2:Development

3:reproduction

4:you are scared

5:homeostasis

7 0
3 years ago
Describe the type of organisms that are classified into the achaea domain
Evgen [1.6K]

Answer: Archaea, (domain Archaea), any of a group of single-celled prokaryotic organisms (that is, organisms whose cells lack a defined nucleus) that have distinct molecular characteristics separating them from bacteria (the other, more prominent group of prokaryotes) as well as from eukaryotes (organisms, including plants and animals, whose cells contain a defined nucleus).

4 0
3 years ago
Other questions:
  • In the graph below, which year most likely had the lowest rainfall?
    6·2 answers
  • To conduct a phylogenetic analysis, an outgroup is needed in order to: all of these choices are correct. determine which charact
    5·1 answer
  • Control of thirst response due to increased plasma osmolarity by a negative feedback loop rank from the first to the last steps
    13·1 answer
  • Match the term with the definition. Match Term. Definition Condensation A) A phase change from a solid to a gas Evaporation B) A
    5·2 answers
  • Please help Most ovens we use at home are powered by electricity or natural gas. These ovens use fossil fuels. Describe why the
    13·2 answers
  • What are some examples of negative feedback?
    6·2 answers
  • The product of the light independent reaction is?
    8·1 answer
  • What other features of annelids appear in other phyla?
    5·1 answer
  • Wht is photosynthesis​
    8·2 answers
  • 1. Which variable should be changed in an experiment to test how much sodium bicarbonate will dissolve in water at 25°C?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!