1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zielflug [23.3K]
4 years ago
6

The breakdown of large molecules by the enzymatic addition of water is an example of what kind of reaction?

Biology
1 answer:
Anton [14]4 years ago
5 0

Hydrolysis is the reaction that stems from the breakdown of large molecules by the enzymatic addition of water. Hydrolysis is step leading to the degradation of the substa…nce. It is a chemical reaction in which a molecule of water is added to a substance.

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
The climate and features of the Earth change over time.
BlackZzzverrR [31]
C. Over many generations, the characteristics of these kinds of organisms also change
3 0
3 years ago
Read 2 more answers
- know the organization of each type of muscle at the tissue and cellular level.
HACTEHA [7]
I have done 7 questions u are my 8th
8 0
4 years ago
You will get brainliest
kiruha [24]

Answer:

please mark me the brainliest

Explanation:

Antarctica, Argentina, Chile, Canada, Alaska, Greenland and Iceland. Mountain glaciers are widespread, especially in the Andes, the Himalayas, the Rocky Mountains, the Caucasus, Scandinavian mountains, and the Alps.

4 0
3 years ago
Nevermindi got the answer
Sergeeva-Olga [200]

Answer:

ok

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • After burning of plant material, where is the carbon returned to?
    9·2 answers
  • Describe what happens to chromosomes before mitosis.
    11·2 answers
  • Sperm cells are found inside pollen. What kind of cells are sperm?
    5·1 answer
  • How does a synthetic sponge mimic a live sponge to pick up dirt?
    7·2 answers
  • Explain how the texture of a rock surface affects how fast it physically weather by water.
    14·1 answer
  • One important function of ovaries is to produce ____________________ cells. a. somatic c. egg b. hair d. sperm
    15·2 answers
  • Which accurately describes the relationship between nutrients and life-forms in an estuary?
    6·1 answer
  • Describe how fleshy fruits get dispersed​
    10·1 answer
  • Which is the correct order in the scientific process?
    7·1 answer
  • Given the sequence of acgtat, read in the 5’ → 3’ direction, what would be the sequence of the opposite strand, read in the 5’ →
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!