<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
The ligand has only one receptor that it is able to bind to
Explanation:
The shape of the ligand and its corresponding receptor allow there to be specificity. For example, receptors for ligand A would be found on the target immune system cells and not on cardiac muscle cells or skin epithelial cells. Therfore, even though the cardiac muscle cells or the skin epithelial cells would be exposed to ligand A, they would not be able to bind to it and therefore could not react because of the specificity of the receptor of ligand A at that moment
G1 is followed by S phase (synthesis), during which DNA replication takes place. The completion of DNA synthesis is followed by the G2 phase (gap 2), during which cell growth continues and proteins are synthesized in preparation for mitosis.
D. an asteroid because an asteroid is the only thing that can form a meteor crater.
Answer: Yes
Explanation:
I’m not sure why it seems right tho