1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ziro4ka [17]
4 years ago
15

The autorhythmicity of cardiac pacemaker cells is made possible by the reduced permeability of _______. The autorhythmicity of c

ardiac pacemaker cells is made possible by the reduced permeability of _______. magnesium sodium calcium potassium
Biology
1 answer:
vichka [17]4 years ago
7 0

Answer:

<h2>potassium</h2>

Explanation:

The heartbeats of the heart are controlled by the sinoatrial node also known as the pacemaker of the heart. The impulse is generated in the conducting cells of the pacemaker as a result of the movement of sodium, potassium and calcium ions.

The sodium channels allow the movement of sodium into the cell which depolarizes the membrane from -60mv to -40 mv. At this point, the calcium gated channels open which allow the entry of the calcium in the cell which depolarizes the cell up to +5mv.

At this point, the potassium channels open which allows the potassium ions to move out of the cell. This repolarizes the cell and hence the cycle again begins.  Reducing the permeability of the potassium ions help generate the autorhythmicity due to repolarization and thus is the correct answer.

You might be interested in
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Within an organism it is critical that signals between cells are very specific.
Shalnov [3]

Answer:

The ligand has only one receptor that it is able to bind to

Explanation:

The shape of the ligand and its corresponding receptor allow there to be specificity. For example, receptors for ligand A would be found on the target immune system cells and not on cardiac muscle cells or skin epithelial cells. Therfore, even though the cardiac muscle cells or the skin epithelial cells would be exposed to ligand A, they would not be able to bind to it and therefore could not react because of the specificity of the receptor of ligand A at that moment

6 0
4 years ago
In which of the following stages does the DNA replication and protein<br> synthesis take place?
Elena-2011 [213]
G1 is followed by S phase (synthesis), during which DNA replication takes place. The completion of DNA synthesis is followed by the G2 phase (gap 2), during which cell growth continues and proteins are synthesized in preparation for mitosis.
5 0
3 years ago
About fifty thousand years ago ______ formed meteor crater
bixtya [17]
D. an asteroid because an asteroid is the only thing that can form a meteor crater. 
3 0
3 years ago
Read 2 more answers
WILL GIVE BRAINLIEST PLEASE HELP
trapecia [35]

Answer: Yes

Explanation:

I’m not sure why it seems right tho

8 0
3 years ago
Other questions:
  • Which type of muscle is found in the lining of the arteries? smooth skeletal cardiac
    6·1 answer
  • There are no fossils of mammals in the oldest layers of rock. What
    8·2 answers
  • when both water and salts are present is a solution and the cell needs water which process enables the cell to obtain the water
    6·2 answers
  • Why does the figure show two different shapes of gametes?
    15·1 answer
  • Two brown-eyed parents I have produced three blue-eyed son. If they have another child, what are the chances that I would also h
    6·1 answer
  • Which of the following is not a reason for the wide use of CFC's during the 1920's - 1990's?
    6·1 answer
  • This paragraph attempts to explain the rain shadow effect, but it gets some of the facts wrong. Identify the inaccurate statemen
    9·2 answers
  • A client has a rash on the arm that has been treated with an antibiotic without eradicating the rash. What type of examination c
    5·1 answer
  • Which stage is the dominant stage in mosses?
    5·1 answer
  • Do all cells have a cell plate?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!