1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
4 years ago
8

How are cell structures adapted to their functions?

Biology
2 answers:
Olegator [25]4 years ago
7 0

Answer: Cell structures adapt by responding to their environments as a group, and evolve over time.

Explanation:

Skin Cell Adaptation : Has many nerves that allow you to sense your surroundings, and allows you to hold and absorb many important nutrients.

Nerve Cell Adaptation : Nerve cells have very long axons being they can deliver messages for a longer time before passing it on to the next cell, which makes this process significantly faster.

Muscle Cell Adaptation : These cells have adapted to their function by being able to increase their size based on the work they do on a regular function.

Red Blood Cell Adaptation : When it removes the carbon dioxide from your body, it moves it to your lungs to exhale.

Dmitriy789 [7]4 years ago
4 0

Answer:

Explanation:

A cell is adapted to its function because of differential expression of genes during fetal development during which they get differentiated and determined to provide division of labour to different tissues. They contain protein fibres that can contract when energy is available, making the cells shorter.

You might be interested in
There are marked differences in the type of organisms found at four different locations at the same tidal height along ta rocky
yawa3891 [41]

Answer and Explanation:

Many elements can be responsible for this, among them, we can mention the presence and absence of predators in the different places on the rocky coast. This is because predators can influence not only the number of organisms found, but also the types of organisms.

Another element that may be the cause of this variability is the availability of resources necessary for the life of these organisms, in addition, the impact of the waves on the rocks, can cause the variability of the organisms, since some may not be able to resist the impact of the waves.

7 0
3 years ago
Wich best decribes the relationship between evolution and natural selection? A. Natural selection. B evolution leads to natural
Fed [463]
Natural selection leads to evolution because the strongest survive and pass on their genes
3 0
3 years ago
Read 2 more answers
Cfhiiiiiuchchcdnjddjdhudfjxjixxu
Korolek [52]

Um, do you need help?

8 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Which of the following statements about asteroids is true?
Dmitrij [34]
I think the answer B
4 0
3 years ago
Other questions:
  • I got a few questions and not a lot of point so please answer .-.
    7·2 answers
  • What is a goblet cell?
    11·1 answer
  • What are the two classes of legumes
    12·1 answer
  • What are 5 properties of water?​
    6·1 answer
  • WILL GIVE BRAINLIEST IF CORRECT <br> What is cell differentiation? Give one example?
    9·2 answers
  • This is an example of which type of visual aid?
    12·2 answers
  • Tundra is not a good growing environment for corn because: true or false
    5·1 answer
  • Which process does not occur in mitosis and why is this important?
    13·1 answer
  • Which of the following flood mitigation techniques might a city use? Select the two correct answers.
    8·1 answer
  • The body monitors the levels of oxygen in the blood to regulate breathing. Isabel is running in a marathon and is near the finis
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!