Answer and Explanation:
Many elements can be responsible for this, among them, we can mention the presence and absence of predators in the different places on the rocky coast. This is because predators can influence not only the number of organisms found, but also the types of organisms.
Another element that may be the cause of this variability is the availability of resources necessary for the life of these organisms, in addition, the impact of the waves on the rocks, can cause the variability of the organisms, since some may not be able to resist the impact of the waves.
Natural selection leads to evolution because the strongest survive and pass on their genes
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T