The number of bushes would decrease, as the bird species would need to eat the berries off of the bush. The species would continue multiplying and eating on the food until there is none left, causing the species to have to migrate to a new area that satisfies there needs.
Answer:
C. both
Explanation:
The particle theory and wave theory are both used today.
The particle theory tells us that light is a particle or photon. The wave theory tells us that light travels in waves.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
There are two significant factors that contribute to Americans having significantly higher rates of cardiovascular disease than Europe which can be attributed to diet and lifestyle. Although there is the presence of fat in the diet in Europe, the U.S. diet contains significant amounts of processed foods and fast food. The lifestyle in the U.S. also has more life stress. The counter example to this is the longer amount of vacation times in Europe and a more relaxed pace towards working, exemplified by the Spanish siesta or after lunch rest/nap.
Carbon, oxygen, & hydrogen may all be elements found in ethanol, but when separated, they have completely different chemical compounds. They are pure elements where as ethanol is a mixture.