1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olchik [2.2K]
3 years ago
10

After replication, ________. each new DNA double helix consists of two old strands each new DNA double helix consists of one old

strand and one new strand each new DNA double helix consists of two new strands one new DNA double helix consists of two old strands and the other new DNA double helix consists of two new strands
Biology
1 answer:
Kaylis [27]3 years ago
6 0

Answer:

each new DNA double helix consists of one old strand and one new strand

Explanation:

<em>Replication </em><em>is a process during which the DNA produces a copy of itself. It is one of the steps involved in gene expression.</em>

During replication, the double helix strands of DNA are separated into individual strands by DNA helicase. Each strand then serve as a template for the synthesis of new complementary copies.

<em>After the synthesis of the complementary copies, the old strands do not wind back together. Instead, they wind with their newly synthesized complementary copies. This results in two DNA double helix with each consisting of one old strand and one new strand.</em>

This is why the replication of DNA is said to be semi-conservative.

You might be interested in
All of the following affect the temperature at which magma forms except what?
krok68 [10]
Viscosity is the only one that doesn’t affect the temperature at which magma forms
5 0
2 years ago
HELP ASAP PLEASEEEE
slega [8]

Explanation:

Answer is 2

It is a nonselective process, so it might cause an allele to disappear from the gene pool by chance.

I hope it's helpful!!

8 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
If photosynthesis produces cellular energy (atp) from sunlight, why do plant cells also need to perform cellular respiration, a
Reika [66]
If a plant just did photosynthesis then the plant would not have any food and just an abundant amount of ATP. they use cellular respiration to make food they can use to grow
8 0
4 years ago
What is the genetic of finger?​
bogdanovich [222]

Explanation:

this is the answer hope it works

6 0
3 years ago
Read 2 more answers
Other questions:
  • A major problem with depending on fossil fuels as primary energy sources is that they are
    9·2 answers
  • Which of the following best describes the difference between selective breeding and natural selection?
    11·1 answer
  • What occurs when one cannot move certain parts of the body
    12·2 answers
  • What is occuring when the sound gets louder ? Check all that apply
    10·1 answer
  • What connection do all living things have with each other
    8·2 answers
  • which two types of waves transfer energy? longitudinal and latitudinal horizontal and vertical transverse and transcends longitu
    8·1 answer
  • Why do you think Hawaii has a “High” level of risk?
    6·2 answers
  • Which of the following is a TRUE statement about the differences between prokaryotic
    15·2 answers
  • The understanding of evolutionary processes has helped scientists in the field of artificial selection. The best example of arti
    5·2 answers
  • What part of the reproductive cycle is a virulent virus in?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!