1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nezavi [6.7K]
3 years ago
9

The cost of a space mission is roughly $60 million. What type of obstacle to space exploration does this represent?

Biology
1 answer:
mestny [16]3 years ago
7 0

funding.......................

You might be interested in
A plant chloroplast is a plastid. <br><br> True or False
MissTica
True I’m pretty dure
4 0
3 years ago
Describe the three main properties of a population​
Tamiku [17]

Population refers to an array of organisms of the similar species, which thrives in a particular geographical region and interbreed. The three main characteristics of a population are density, size, and dispersion.  

The density signifies towards how many organisms are thriving in a specific region. The size refers to how big a population is, and dispersion signifies towards the degree of spreading of the particular population.  

4 0
3 years ago
Whether a fly has white or red eyes is due to alleles at a single locus. It is thus a _______ or _______ trait.
maxonik [38]

Answer:

The correct answer is "qualitative, discrete".

Explanation:

A qualitative or discrete trait is defined as a characteristic that have no intermediate features, and is often the result of genetic alleles at a single locus. For instance, if the form the seeds of pea could be either round or wrinkled, but not with intermediate forms. This is the case of the fly that has white or red eyes, but does not have pink eyes or other colors in between.

8 0
3 years ago
Describe the base-pairing rules in any DNA molecule
In-s [12.5K]
The selective pairing of adenine (A) with thymine (T) and guanine (G) with cytosine (C) is based on the number of hydrogen bonds established between one of the purine bases and the one pyrimidine bases
6 0
3 years ago
What is the responsibility of DNA in the cell
Schach [20]

Answer:

It helps make protiens and is like a blueprint for your body.

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • According to the Richer scale, a reading of 2.0 would cause _____ damage, as opposed to a reading of 7.0, which would cause ____
    9·1 answer
  • A 45-year-old man has received a series of immunizing drugs in preparation for a trip to a developing country. within hours, his
    8·1 answer
  • Each organism in a population produces more offspring than can survive. This is called .
    5·1 answer
  • he __________ system works with the nervous system to protect important organs such as the brain and spinal cord. A) skeletal B)
    6·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • 9. Doctors tested a patient to find out what molecules were in her cells. Her cells contained normal
    6·1 answer
  • Did michelle obama make any major mistakes or bad decisions?
    15·1 answer
  • What was Harriet Tubman's Quote?
    6·1 answer
  • 10. A proposed explanation for a scientific
    10·1 answer
  • An increase in atmospheric _____ leads to an increase in the greenhouse effect
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!