Gene, as such traits are passed down through genes
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Plant cells do not perform respiration, so A,C, and D couldn't be correct but they don't digest either. so gain energy plants go through a light dependent reaction and the Calvin cycle which makes up photosynthesis.
Warm ocean currents originate near the equator and move towards the poles or higher latitudes while cold currents originate near the poles or higher latitudes and move towards the tropics or lower latitudes. The current's direction and speed depend on the shoreline and the ocean floor.
