1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ira [324]
3 years ago
13

Explain why it can be useful for you and your doctors to know your family’s medical history, including information about parents

and grandparents
Biology
2 answers:
Anna11 [10]3 years ago
8 0
It can be useful for both the patient and doctor to be aware of the families medical history because testings for and illnesses or medical injuries can be brought down to ensure the bloodline doesn’t receive those same issues as well. For example, if the patients grandparents and parents have a history of cancer it is best to screen for cancer in the patient to make sure it hasn’t passed down through generations. This is the same for allergies and age.
GarryVolchara [31]3 years ago
6 0

Answer:

sv mdn v nvsvs nsvfn vfs nsvsv n.v nsv f S

Explanation:

You might be interested in
A finch population eats seeds that vary in size. There is variation in preference of seed type, and that variation positively co
ladessa [460]

Answer:

If larger seed became available, directional selection will act in favor of bigger beak finch.

Explanation:

In the case that more large seeds were to become available, then directional selection will start to influence in the beak size, favoring those individuals with bigger beaks. Those individuals with shorter beaks will start to disappear as these animals won't be able to eat the larger seed.

Directional selection <em>increases the proportion of individuals with an extreme phenotypic trait,</em> in this case, large beaks.

This selection presents more frequently in those cases in which <em>interactions between living organisms and the environment</em> modify in the same direction.

6 0
3 years ago
Match these items.
Gnesinka [82]

Answer: pancreas- secretes enzymes

Gall bladder- stores bile

Liver:makes bile

Salivary glands: found in mouth

Explanation:

5 0
3 years ago
List 3 benefits of the development of seeds and fruits.
Anna11 [10]

Explanation:

The fruits protect the seeds enclosed in the ovary. The seeds mature in the fruit by taking essential requirements.

The mature seeds retain the capacity of germination for a long period. It may be dispersed individually or along with the fruits to long distances by different agencies. The seeds germinate in the favorable conditions.

These are the advantages of fruits and seeds in the Angiosperms. These advantages help the spread of the Angiosperms in different climatic conditions. Thank you

3 0
3 years ago
The prostate gland is described in all of the following ways​ except:
andrey2020 [161]

Answer:

The correct answer will be option- D.

Explanation:

The prostate gland is a walnut-shaped gland present between the bladder and penis.

The prostate gland is a part of the reproductive system and not the urinary system as it helps in the nourishment and protection of the sperm cells. It secretes a fluid which contains enzymes like phosphatases, lytic enzymes and antibiotics which helps in the protection and passage of sperm to the egg cell.

Thus, option- D is the correct answer.

8 0
4 years ago
When you look at the Sun through a filtered telescope, you notice a blotchy appearance.
e-lub [12.9K]
The part of the Sun that you are observing when you see a blotchy appearance is the surface of the sun. This appearance is called granulation which is caused by the convection of the hot material inside the sun which go up and down the surface of the sun. Because of its sandy texture it is sometimes called lemon peel or rice grain.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Can you check my work for this worksheet?
    8·1 answer
  • A 37-year-old semiconscious male sustained a stab wound lateral to the left side of the sternum. he presents with signs of shock
    9·1 answer
  • The Two Main Processes By Which Plant Cells Absorb Release And Use Energy
    12·2 answers
  • Why do people tend to cup their hands around listeners' ears when whispering to them?
    9·2 answers
  • Plastics remain in the ocean environment because of their stability and resistance to degradation or biological processing. they
    15·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which of the following is NOT a program that receives government outlays? A. corporations B. aid programs C. disaster relief D.
    13·2 answers
  • What is the source of the carbon dioxide that is used in photosynthesis?
    8·1 answer
  • 20 POINTS
    5·1 answer
  • why is it important to have the contributions of scientific from backgrounds when evaluating scientific claims?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!