1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NARA [144]
3 years ago
11

If you were making observations of someone mixing two substances together, how would you know if a chemical reaction took place?

Biology
1 answer:
bezimeni [28]3 years ago
5 0

if you were making an observation of two substances, The five conditions of chemical change would be color chage, formation of a precipitate, formation of a gas, odor change, temperature change. i hope this helps

You might be interested in
Which of the following is NOT a red flag about your alcohol consumption?
FinnZ [79.3K]
What are the answer choices?
3 0
3 years ago
How is the structure of limonene similar to the structure of cyclohexene?
Triss [41]
They both include the same acid

4 0
3 years ago
The passage describes some glycolysis reactions. Select the appropriate term for each blank to complete the passage. In the firs
Korolek [52]

Answer:

JUST VOODSE

Explanation:

BRIUH

3 0
3 years ago
What makes up for an ideal cell?
SVEN [57.7K]

Answer:

Ideal cell is defined to be the cell will zero internal resistance.

4 0
3 years ago
PLEASE HELP!!!!!
Diano4ka-milaya [45]

Answer:

Anaphase

Explanation:

Metaphase leads to anaphase, during which each chromosome's sister chromatids separate and move to opposite poles of the cell.

7 0
3 years ago
Other questions:
  • What could be the reason for this
    9·1 answer
  • Item 2 Item 2 Osmometer cells in the brain sense an increase in the salt concentration of plasma. This information is sent to th
    7·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The spinal cord is made up of
    8·2 answers
  • Sea otters are important predators of sea urchins, an animal that eats giant brown kelp in continental shelf zones where they fo
    6·2 answers
  • Rust results from iron’s reaction to oxygen. An iron nail gains mass when it rusts. How does this reaction support the law of co
    8·2 answers
  • What are your thoughts on climate change? Explain 4-5 sentences
    12·1 answer
  • Which statement below best describes the relationship between natural selection and adaptation?
    13·2 answers
  • In three to five sentences explain how resource scarcity, competition, and the survival of organisms are connected. (4 points)
    13·1 answer
  • Is the virus considered a living creature? Justify the answer.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!