1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovangra [49]
3 years ago
6

which is a property of all ionic compounds that makes chalk particularly useful for writing on a chalkboard?

Biology
1 answer:
a_sh-v [17]3 years ago
5 0
The property of all ionic compounds that makes chalk particularly useful for writing on a chalkboard is : Hardness and Brittleness

Those properties make chalk leaves residues on the board every time friction happen between the chalk and the board

hope this helps<span />
You might be interested in
Put the following stages in order: G2,G1, S, mitosis, cytokinesis.
Oliga [24]
G1, S, G2, Mitosis, Cytokinesis

Just did this yesterday lol hope it helps


3 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
All of the following statements about the hydrosphere are true except:
Paha777 [63]
The hydrosphere is defined as the water surrounding the surface of globe include oceans lakes etc
The statement that is not correct about hydrosphere is
Most of the water making up the hydrosphere is in lakes
because its not lakes its oceans
so correct option is B
hope it helps
7 0
3 years ago
Read 2 more answers
The type of inheritance that involves the partial expression of two different
liraira [26]

Answer:

D. Codominance

Explanation:

Codominance is when both alleles are expressed with the resulting phenotype being the intermediate of the two. For example, red and white phenotypes results to a pink one.

3 0
2 years ago
An example of internalization of behaviors as a result of stress is
11Alexandr11 [23.1K]
An <span>example of internalization of behaviors as a result of stress is irritability. irritability is largely affected by external factors that could have shifted one's mood. For example, a person is pressured by his boss everytime for the deadline so when he reaches home, he always shout his younger brothers/sisters.</span>
8 0
3 years ago
Other questions:
  • The bee is pollinating the flower. This is an important step in the ____________ of flowering plants.
    9·1 answer
  • 5. How are photosynthesis and cellular respiration related?
    9·1 answer
  • Suppose a scientific team is trying to re-create the energy producing reactions that occur in the sun. What would they need for
    14·2 answers
  • Look at fig. 132 where the Punnett square shows a homozygous red grapfruit
    15·1 answer
  • Explain how RNA polymerase recognizes where transcription should begin. Describe the promoter, the terminator, and the transcrip
    5·1 answer
  • Which of the following statements concerning photosynthesis is NOT true?
    7·2 answers
  • Would you expect older volcanoes to be seamounts or islands
    10·1 answer
  • ITS A TIME LIMIT PLZ HURRY
    12·1 answer
  • The salivary glands under the tongue are described as
    12·1 answer
  • There are 3 types of polar bears: ones with thick coats, ones with thin
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!