1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
3 years ago
11

Legumes host nitrogen fixing bacteria, and

Biology
1 answer:
levacccp [35]3 years ago
6 0
The answer is soybean
You might be interested in
Two types of RNA molecules are...
romanna [79]
Messenger and transfer RNA
3 0
2 years ago
What is missing from this food chain?
Ierofanga [76]

the decomposer is missing. The rabbit is the herbivore, the rasberry bush is the producer, and the owl is the consumer. The decompoer is the only thing not on there.

8 0
3 years ago
Read 2 more answers
Which of the following terms would be an appropriate title for the level of complexity labeled X?
ipn [44]
The answer is C. Organism.
6 0
3 years ago
Read 2 more answers
2 ways that the forelimbs are different than hind legs
mario62 [17]
1. Hind limbs tend to be sturdier, longer, stronger. 
<span>2. The hind limbs are more firmly attached to the spine than are the forelimbs.</span>
5 0
3 years ago
What is some strengths as a math learner
irina1246 [14]
Some strengths are,

you get faster at answering questions, it’s easier to understand the problems, you have more strategy’s, you understand the ration and percent. you can use graphs and number lines much easier.


i’m doing mental math right now and this is what we were going over,


i hope it helps
5 0
3 years ago
Other questions:
  • Pls help i’m miserable
    15·1 answer
  • Waste in high income countries is made up of mostly
    8·2 answers
  • What diseases is cause by cigarette smoke
    8·1 answer
  • We refer to the Dna code as being redundant or repetitive. This means that
    12·1 answer
  • How many bones are in the human ear?
    12·1 answer
  • A group of nursing students is reviewing the similarities and differences between bulimia nervosa and binge eating disorder (bed
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • In China, many people wear face masks while outside due to heavy air pollution. Which of these factors will most likely reduce a
    9·1 answer
  • (edit) i found the answer myself
    14·1 answer
  • Which method provides the most accurate age of a rock sample ?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!