1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
leonid [27]
3 years ago
8

Are fatty streaks formed by multiple foam cells?

Biology
1 answer:
katovenus [111]3 years ago
5 0

the answer is a big n-o. or false, if its true or false

You might be interested in
The primary motor cortex for control of voluntary muscles is found in the
miss Akunina [59]

Answer: The primary motor cortex for control of voluntary muscles is found in the precentral gyrus of the frontal lobes.

Explanations:

The primary motor cortex is one of the important brain areas involved in motor function. It is found in the precentral gyrus of frontal lobes. It control voluntary muscles and generate impulses needed for movement execution.

Voluntary muscles are muscles that we can control consciously or we can control them at will and we can choose when we want to use them. They are also refers to as skeletal muscles and are attached to bones. The are majorly use for locomotion.

5 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Northern flickers are woodpeckers of the eastern United States. Males, but not females, have black feathers that resemble a mous
jek_recluse [69]

Answer:

This suggests that the moustache is a releaser for aggression.

Explanation:

<em>Fixed action patterns</em> are instinctive programmed responses in different species that are triggered by a specific external sensory stimulus. These stimuli are called sign stimuli or releaser. When the sign occurs, the animal starts a sequence of acts in response to the stimulus and continuous until the series of actions is completed.

The black feathers resembling a mustache in a <em>Northern flickers</em> male are an external sensory stimulus. This trait that can provoke another male to respond aggressively, as a f<em>ixed action pattern</em>.  

This trait might be considered as an <em>unconditioned stimulus</em>, which <em>provokes an unlearned or reflex reaction</em>. These aggressive responses are triggered by reflex.

7 0
3 years ago
Somatic cells in humans differs from gametes in that human somatic cells __________.
Jobisdone [24]

Answer:

contain two sets of each of the 23 chromosome types

4 0
1 year ago
Temperature of sickle star
vfiekz [6]

Answer:

69 degrees

Explanation:

6 0
3 years ago
Other questions:
  • Which of these is an example that scientific knowledge can be reviewed
    5·1 answer
  • Organisms can be classified in the same species by morphology and ___
    11·2 answers
  • Fossils may be:
    15·1 answer
  • Classification is an important aspect of understanding and describing the many life forms on earth. In their classification sche
    7·1 answer
  • By which process do plants lose their water to the atmosphere?
    5·1 answer
  • 11. What type of cell is formed in this MALE organism at stage D? *
    11·1 answer
  • Sometimes the leaves of plants contain white patches. The cells in this part of the plant most likely cannot
    15·2 answers
  • Spatial perception and the recognition of familiar objects require activity in which of the following cortical regions?
    10·1 answer
  • Choose one the correct types of weathering and type it in the box exactly as it is written!
    12·2 answers
  • 2. If you could magnify the surface of a leaf to see it up close what type of structures, do you think you might see
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!