3 years ago

Why are the interactions and tissues in the menstural cycle considered to be feedback mechanisms

1 answer:

7 0

it is considered feedback mechanisms because the menstrual cycle only happens when the hormone is released, it causes the target tissues to react, that reaction is the feedback.

You might be interested in

I need help with this

Gekata [30.6K]

What do u need help with?

7 0

3 years ago

Plz help will be marked BRAINLIEST

Ivenika [448]

Answer:

Cranial capacity increased the most from 2 million years ago to the present.

Explanation:

The rate of change is greatest between 2 million years ago and the present.

4 0

3 years ago

Read 2 more answers

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0

3 years ago

Help please please please help

vagabundo [1.1K]

the answer is C or the third one down, Layer A is the outer core because its made of iron and nickel

6 0

4 years ago

What is the most common type of synapse in the brain?

Vsevolod [243]

Electrical synapses, I believe.

8 0

3 years ago