1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Agata [3.3K]
3 years ago
8

With regard to the process of neural transmission, a refractory period refers to a time interval in which:

Biology
1 answer:
frutty [35]3 years ago
7 0
<h3><u>Answer;</u></h3>

d. a neuron recharges before it can fire again.

<h3><u>Explanation;</u></h3>
  • <em><u>Refractory periods are a short phase in time following an action potential where another action potential cannot be generated. </u></em>
  • <em><u>It is the period immediately following the transmission of an impulse in nerve or muscle, in which a neuron or muscle cell regains its ability to transmit another impulse. </u></em>
  • There are two types of refractory period, that is the absolute refractory period and the relative refractory period. Absolute refractory period is the first part of a refractory period during which, the neuron will not fire again no matter how great the stimulation and this only lasts for a short time.
  • Relative refractory period occurs when a stronger than usual stimulus is required to trigger the action potential before the neuron returns to resting state.
You might be interested in
honeybee is considered as the most useful insect for human beings.justify this statement with any three reasons​
Oduvanchick [21]

Answer:

  • Polinate plants, trees and food
  • They give us honey
  • bees are responcible of pollinating 15 billion of just US crops and 200 million pounds of UK crops. showing their contribution to agriculture

6 0
3 years ago
If a eukaryotic cell has 20 chromosomes and it undergoes meiosis, how many cells will result, and how many chromosomes will they
Ivanshal [37]
4 cells will result. Each cell will have 20 Chromatids which is half a chromosome. once sexual reproduction takes place, these 20 chromatids will match with those from the other parent cell to form chromosomes 
5 0
4 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Three nose configurations found on long nose pliers are
Scilla [17]
The three nose configuration found on long nose pliers are NEEDLE, CHAIN AND ROUND
Long nose pliers may or may not have side cutters and they come in miniature and small sizes. Long nose pliers are designed for electrical work, it is used for cutting small wire gauges.
3 0
4 years ago
Will give brainliest plz help <br> Answer 14
weeeeeb [17]

Answer:

liquid- enzymes

protein- fat

carbohydrate- saccharides

nuclei acid- dna or deoxyribonucleic acid

3 0
4 years ago
Other questions:
  • Does the heart shaped plant contain the same genetic formation as the leafy plant
    13·1 answer
  • Which question can be answered using the scientific process ?
    9·2 answers
  • This is a disorder in which people mistakenly fear that minor changes in their physical functioning indicate a serious disease.
    12·1 answer
  • which renewable energy source is most likely to become non renewable if we as consumers aren't careful? biomass energy geotherma
    11·2 answers
  • Can a theory change over time? If so, how?
    14·1 answer
  • What event occurs in photosystem 1?
    14·1 answer
  • Why is it important to have regular supervision of the weight and measurements in the market?
    6·1 answer
  • Which of the following must be met for a scientifically valid sample? Subjects are selected:
    12·2 answers
  • Please help <br><br> Fast. HELP
    12·2 answers
  • Before the summer break, your class created a garden bed for the next incoming class in the fall. Nothing was planted, but soil
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!