1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zielflug [23.3K]
3 years ago
10

in the box below, please illustrate any enzymes and substrate. label the following key words in your illustration: enzymes, subs

trate, and active site

Biology
1 answer:
iogann1982 [59]3 years ago
3 0

Explanation:

  • Enzymes are biological catalysts that speed up biochemical reactions.
  • A substrate is the molecule that the enzyme acts upon and converts to product.
  • An active site is the part of the enzyme where the substrate binds to it. Active sites contain a specific amino acid sequence and conformation which make it easy for the substrate to bind.
  • Enzymes are stringently substrate specific i.e. only a certain substrate can fit in and bind to the active site of a specific enzyme, just like only one key can fit into a specific lock.

You might be interested in
What other compound must be present along with urea for the urease enzyme to break down urea?
MaRussiya [10]

Water is the compound must be present along with urea for the break down of urea.Thus, option B is correct.

<h3>What does urea break down into?</h3>

Urea and water combined together and results  into the production of carbon dioxide and ammonia with the help of urease enzyme.

Urea + water = Carbon dioxide+ ammonia

Breakdown of urea occurs in a cycle known as urea cycle and it has five important steps:

  • Formation of carbamoyl phosphate
  • Synthesis of citrulline
  • Cleavage of argininosuccinate
  • Glucogenic and ketogenic amino acids
  • Oxidation of Carbon skeleton of amino acids

Therefore,water is the compound must be present during the process of break down of urea.Thus, option B is correct.

Learn more about break down of urea here:

brainly.com/question/11486679

#SPJ4

Your question is incomplete,but most probably your full question was,

What other compound must be present along with urea for the urease enzyme to break down urea?

A.ammonia

B.water

C. pyruvic acid

D. carbon dioxide

7 0
1 year ago
A gene is a subunit of information on a chromosome true or false?
xeze [42]
<span>The gene, is in fact the subunit of information on a chromosome, so this is a true statement. A chromosome is a structure that occurs within cells. It contains the cell's genetic material, which determines how an organism develops. For example, if we are talking about DNA, its molecule is a very long, coiled structure that contains many identifiable subunits known as genes.</span>
4 0
3 years ago
Read 2 more answers
Pea plants have purple flowers that are dominant to white flowers.
lidiya [134]

Answer:

b 2 purple 2 white

Explanation:

6 0
3 years ago
Which tool would you use to predict the percentage of offspring that will have a specific trait?
Alona [7]

Answer:

Punnett square

Explanation:

Unlike the pedigree chart, which shows all possible offspring with a specific gene, the punnett square shows how many could have each genes.

8 0
3 years ago
Read 2 more answers
When does fermentation take place in your muscle cells
Ivahew [28]

<u>Answer:</u> Human muscle cells also use fermentation. This occurs when muscle cells cannot get oxygen fast enough to meet their energy needs through aerobic respiration. There are two types of fermentation: lactic acid fermentation and alcoholic fermentation.

5 0
3 years ago
Other questions:
  • A client who is uncertain when her lmp occurred is given an edd of april 23 after the first ultrasound. based on this informatio
    13·1 answer
  • Its cells are not thought to contain mitochondria but do contain genes that are similar to the genes for muscle proteins.
    13·1 answer
  • Help me in biology please...
    8·2 answers
  • Enzymes are catalysts because they<br> lower the<br> of a chemical<br> reaction
    5·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • In a car accident investigation, forensic investigators could not locate the antemortem dental record of the victim for comparat
    6·2 answers
  • Human disruption of the carbon cycle has been implicated in..?
    9·1 answer
  • What is the density of an object with a mass of 100 g and a volume of 50 cm3?
    12·2 answers
  • How are the processes of evaporation and condensation similar? Both evaporation and condensation –
    8·1 answer
  • Burning fossil fuels involves releasing carbon dioxide and other greenhouse gases into the atmosphere at a rate that is much fas
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!