1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sati [7]
3 years ago
7

Have both metallic and nonmetallic properties

Biology
1 answer:
Montano1993 [528]3 years ago
7 0
The answer is C. Metalloids
You might be interested in
What is a Neuronal Action Potential
jonny [76]

Answer:

B. method by which neurons communicate

4 0
3 years ago
How is HIV contracted, and what are the treatment options?
Katena32 [7]

I believe the correct answer is: HIV is spread during unprotected sex or through contact with infected blood; it cannot be cured, but early treatment can minimize the long-term consequences.

<h2>Explanation:</h2>

Human Immunodeficiency Virus is a type of virus which causes an impairment of the immune system of the person making them susceptible to diseases such as tuberculosis, influenza and any other disease that can exploit this opportunity. It is spread by a person coming into direct contact with infected bodily fluids such as saliva during deep kissing, semen during intercourse, blood after an accident or even fluids when sharing needles and syringes for drug addicts. There is no cure but the current form of treatment slows down the virus to prevent some consequences.

<h2>Further Explanation:</h2>

The virus is enters the body through open wounds or surfaces such as the vagina or mouth where the skin is very thin and can tear. After penetrating the skin, it attaches to specific immune cells called CD8+ T-cells on points called receptors. It then enters the cell and replicates itself in the nucleus of the cell and as it goes out, it kills these immune cells making the person to have a weak immune system. The current drugs used called AntiRetroVirals (ARVs) such as the drug Zidovudin stops the virus from replicating thus reducing the total amount of virus in the body called the Viral Load. Some drugs target enzymes called proteases and reverse transcriptase that help the virus to replicate. This viral load is what is counted to estimate the total volume of HIV someone has in their body. Infected persons should use protection while having sex and also avoid sharing sharp objects to prevent transmission. They also need to take their medication to make them much more healthier in addition to taking proper balanced diets.

Level: High School

Subject: Biology

Topic: The Immune System

4 0
3 years ago
Read 2 more answers
The four nucleotides found in human DNA (G, A, T, C) combine in groups of three to create potentially 64 different amino acids,
Liula [17]

Question 1

Answer:

D- Different nucleotide combinations code for the same amino acid.

Explanation:

Some amino acid has more than one nucleotide combination coding for it.

Question 2

Answer:

B- Redundancy

Explanation:

Redundancy means that more than one codon is assigned for the coding of most amino acids.

Question 3

Answer:

0%

Explanation:

Since both parents are homozygous dominant and recessive respectively, no crossing can give the homozygous dominant as all offspring are heterozygous.                  

Question 4

Answer:

Homozygous.

Explanation:

The genotype 'dd' is homozygous since the two letters are both in the lower case.

Question 5

Answer:

25%                

Question 6

Answer:

Dihybrid cross

3 0
3 years ago
Define negative feedback of homeostasis
Nadya [2.5K]

Answer:

A negative feedback loop is a reaction that causes a decrease in function. It occurs in response to some kind of stimulus. Often, it causes the output of a system to be lessened; so, the feedback tends to stabilize the system. This can be referred to as homeostasis, as in biology, or equilibrium, as in mechanics.

plz give brainlist

hope this helped

3 0
3 years ago
What is most likely to happen when water loses heat
LiRa [457]

Answer:

it will turn to ice

Explanation:

the potential energy in the molecules is reduced and they start to move alot slower, eventually they stick together and form ice

4 0
2 years ago
Other questions:
  • What causes a star to shine brightly
    13·2 answers
  • What is the waste product formed during the kerbs cycle
    8·2 answers
  • If the blow to jorge's head fracture the bone just lateral to his eye, which bone would that be
    7·1 answer
  • The shoulder is _to the elbow
    12·1 answer
  • Control of temperature endocrine activity and thirst are functions associated with the ________.
    8·1 answer
  • How come plant cells have a cell wall but our cells don't?
    11·1 answer
  • What would happen if the fatty acids in cell membrane were polar molecules
    11·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • How does the WaterSense program work?
    10·1 answer
  • The intensity of the sunlight hitting the planet as Earth revolves around the Sun varies because of what reasons? Select all tha
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!