1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LiRa [457]
4 years ago
6

The potential energy in atp is released when the terminal high-energy bond is broken by a process called

Biology
1 answer:
irina [24]4 years ago
7 0
I think it is called "dephosphorylation."
You might be interested in
Genetic linkage mapping for a large number of families identifies 4% recombination between the genes for Rh blood type and ellip
Cloud [144]

Answer:

0.2404

Explanation:

The genes R/r and E/e are linked and there is 4% recombination between them.

<u>The possible genotypes and phenotypes are:</u>

  • RR or Rr: Rh+ blood type
  • rr: Rh- blood type
  • EE or Ee: elliptocytosis
  • ee: normal red blood cells

Tom and Terri each have elliptocytosis (they are E_), and each is Rh+ (they are R_).

Tom's mother has elliptocytosis (E_) and is Rh- (rr), so she has the genotype Er/_r. His father is healthy (ee) and has Rh+ (R_), so he has the genotype eR/e_. Tom must have inherited his E allele from his mother and his R allele  from his father, so he has the genotype eR/Er.

Terri's father is Rh+ (R_) and has elliptocytosis (E_), while Terri's mother is Rh- (rr) and is healthy (ee) with the genotype er/er. Terry could only receive the chromosome <em>er </em>from her mother, and because she is heterozygous for both genes the dominant alleles were both received from her father. Terri's genotype is ER/er.

The frequency of recombination is 4%, so 4% of the produced gametes will be recombinant. There are two possible recombinant gametes, so each will appear 2% of the times (a frequency of 0.02).

<u />

<u>Tom will produce the following gametes:</u>

  • eR, parental (0.48)
  • Er, parental (0.48)
  • er, recombinant (0.02)
  • ER (recombinant (0.02)

<u>Terri will produce the following gametes:</u>

  • ER, parental (0.48)
  • er, parental (0.48)
  • Er, recombinant (0.02)
  • eR, recombinant (0.02)

A child Rh- with elliptocytosis has the genotype rrE_. This can happen from the independent combination of the following gametes from Tom and Terri respectively:

  • Er (0.48) × er (0.48) = 0.2304 Er/er
  • Er (0.48) × Er (0.02) = 0.0096 Er/Er
  • er (0.02) × Er (0.02) = 0.0004 er/Er

And the total probability of having a rrE_ child will be 0.2304 + 0.0096 + 0.0004 = 0.2404

6 0
3 years ago
Which scientist discovered that Venus has phases like the moon’s phases?
Rufina [12.5K]
Your answer is Galileo Galilei. He discovered this is 1610.

I hope this helps!
4 0
3 years ago
Read 2 more answers
Upon your arrival for a burn​ patient, the scene​ size-up reveals that the patient is a child. why do pediatric patients have mo
Alla [95]
This is because pediatric patients have a high body surface area, to the body weight ratio. I hope that this helps you!
8 0
3 years ago
Structure in an animal cell that helps to organize cell division
Luden [163]

Answer:

Centrioles are located near the nucleus and help organize cell division.

8 0
2 years ago
Could plant roots do photosynthesis? Give reasons for your answer.
Murljashka [212]
No. Because plant roots do not have access to direct sunlight. And sunlight is needed for photosynthesis.
7 0
4 years ago
Other questions:
  • What type of ion channel is responsible for the depolarization phase of an action potential?
    13·1 answer
  • PLZ NEED HELP ASAP (DIS IS TIMED)
    9·2 answers
  • Karen's blood type is b+. Jeremy's blood type is a+. Karen and jeremy have a child together, tommy. Tommy's blood type is o
    12·1 answer
  • What is the difference between chromosome translocation and crossing over?
    8·1 answer
  • Which is the main reason cells are replaced in the body?. The cells are too large.. The cells are inactive.. The cells are damag
    12·2 answers
  • HELPPPPP LOTS OF POINTS
    15·2 answers
  • Which process is catalyzed by rubisco during the light-independent reaction of photosynthesis
    9·1 answer
  • Plss I really need ur help: if you guys found a link please type it under ur answer.
    14·1 answer
  • Which is not part of the recipe for a thunderstorm to form?
    14·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!