The diseases which can be passes down as genetic traits are known as "Inheritable disease" some examples are:
1) Haemophilia
2) Phenylketonuria
3) Down's Syndrome
4) Turner's Syndrome
5) Klinefelter's Syndrome
Hope this helps!
Phylogenetic trees show the evolutionary pathways and connections among organisms. A phylogenetic tree is a diagram used to reflect evolutionary relationships among organisms or groups of organisms.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
Immediately, the pathogen has been recognized:
Macrophages acts as the first line of defence by engulfing pathogens identified by antigens which will now present the antibody shape to a helper T cell.
The Helper T cells produce a signal to plasma and Memory B cells to yield antibodies that attach to the antigens. The cytotoxic cells that leads to cell death are activated by the helper T cells.
Antibodies helps to immobilize pathogen for macrophage to feed on.
if the pathogen comes back a 2nd time the memory cells helps in quick and efficient recovery by producing the specific B and T cells for the antigen.
Endocrine. Because insulin is a hormone that are produced in the endocrine gland such as pancreatic gland
