1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fynjy0 [20]
2 years ago
5

Explain how the law of dominance is related to meiosis.

Biology
1 answer:
guapka [62]2 years ago
5 0

Answer:

In essence, the law states that copies of genes separate or segregate so that each gamete receives only one allele. ... The behavior of homologous chromosomes during meiosis can account for the segregation of the alleles at each genetic locus to different gametes.

Explanation:

You might be interested in
10. If you have ever noticed a sharp odor in the air after a thunderstorm
Stolb23 [73]

Answer:

Ozone high in the atmosphere is a pollutant, but near Earth's surface, it provides protection from harmful rays.

Explanation:

I had this test last week so here you go, let me know if it helped!

6 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Deep-ocean lantern fish have special organs that use chemical energy to produce light. However, the light can only travel a cert
Ivanshal [37]
Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.
The  phenomenon validate the Law of Conservation of Energy is "
<span>The light energy travels through the water until it is reflected or absorbed. "</span>
5 0
3 years ago
Read 2 more answers
स्कैरिस क्या है<br>scariest kya hai ​
alukav5142 [94]

Answer:

Ascaris

Explanation:

7 0
3 years ago
The Sun is a significant factor that helps to support life. Which of the following Earth-Sun relationships is not true? The sun'
Usimov [2.4K]
<span> 4th planet from the Sun, which is a perfect distance to utilize the Sun's energy

</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is a contributing reason behind emerging disease?
    14·1 answer
  • In the 1900s, many hydroelectric dams were built in order to hamess the energy of moving water. The dams supplied a clean source
    6·1 answer
  • What caused the mass extinction 65 million years ago that caused 75% of all species of plants and animals disappeared within a f
    10·1 answer
  • The rusty crayfish is harmful to native species of crayfish because it clear cuts the bottom of waterways leaving native species
    8·2 answers
  • How are pounds converted to newtons? Give an example.<br> can someone help me
    6·1 answer
  • Which process is characterized by the movement of particles from an area of high concentration to an area of low concentration a
    6·2 answers
  • Which label belongs in the area marked "Y"? may change the type of amino acid decreases the number of bases in the sequence neve
    5·2 answers
  • Why couldn’t the amoeba taste PTC paper?
    14·1 answer
  • Which of the following statements is a scientific hypothesis(that is, it makes a testable predictions). Choose only one
    11·1 answer
  • Which animals in the Epipelagic Zone are both producers,consumers,and decomposers
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!