1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marrrta [24]
3 years ago
6

Describe the differences between the sporophyte and gametophyte generations of seedless tracheophyte plants and be sure to discu

ss structures and ploidy.
Biology
1 answer:
kykrilka [37]3 years ago
3 0

Answer and Explanation:

Tracheophyte plants, also known as vascular plants, are those that possess a supportive tissue that can also conduct fluids -The Xileme- and another tissue that conducts nutritious elements produced by photosynthesis -The Phloem-. These plants have a root (basically underground), a stem (aerial), and leaves. All of them together form the corm. And the corm counts with these vascular tissues to which we referred before.  

There are different types of Tracheophyte plants, some of them produce seeds to reproduce and disperse -Spermatophyta-  and some others reproduce and disperse by spores -Pteridophyta-. This last seedless group corresponds to ferns and other similar plants.

Pteridophytes characterizes for having a sporophyte that has stems with leaves and a root. It also has primitive xylem composed by tracheids and phloem, both of them formed by vascular bundles located in a central cylinder.

Spores are its dispersion units and are responsible for colonizing new areas. They also constitute the resistance units under extremely unfavorable conditions.  

Their life cycle is composed of the asexual phase (sporophytic phase) and the sexual phase (gametophytic).  

  • The <u>sporophyte</u>, the dominant asexual generation, it is a perennial and diploid structure. Its aerial part might disappear during unfavorable seasons, but it reappears during spring or summer.  The sporophyte is in charge of asexual reproduction
  • The<u> gametophyte</u>, instead, is and haploid structure, ephemeral and must be in the water for its survival, and for sexual reproduction to be successful. In the presence of water, masculine gametophyte -antherozoids- are released and they swim to the archegonium to meet the ovocell. Antherozoids can swim because they have flagella. After fertilization, a new sporophyte is produced.  

You might be interested in
How does a model differ from a law or a theory?
marysya [2.9K]

Answer:

models are universal. option A

3 0
3 years ago
Evidence for evolution includes the presence of _______________________, which are similar structures shared by different specie
3241004551 [841]
Homologous structures (D)
5 0
3 years ago
Read 2 more answers
Suppose you are studying coyotes and wolves, and you determine that wolves are experiencing a reduction in their population that
PolarNik [594]
<span>If one determines that wolves are experiencing a reduction in their population that can be attributed to a virus the coyotes carry that is more harmful in wolves. this is an example of apparent competition.</span>
4 0
3 years ago
What is the scientific name for the layer of gas that surrounds the Earth?
Serga [27]
<span>D. Atmosphere is the answer to this question 
</span>
6 0
3 years ago
Read 2 more answers
Evolution refers to which of the following?
slava [35]

Answer:

having traits that help a single organism survive

4 0
4 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Sometimes a few individuals are isolated from the rest of the population and can have very different gene frequencies. This is c
    6·1 answer
  • The proposed kingdom Euglenozoa includes protists with one or two _____ emerging from an anterior pocket.
    12·1 answer
  • What is the formula mass of sulfur dioxide
    12·1 answer
  • The group names 1-8 on the periodic table
    11·1 answer
  • Each day, your body sheds tens of thousands of skin cells. In a little more than one month, your body replaces all the cells of
    11·1 answer
  • Allopatric speciation is another name for
    7·2 answers
  • Order the following terms from smallest to largest: genome, atoms, DNA, chromosomes, molecules, chromatids, nucleotide, gene
    15·1 answer
  • A solid is that form of matter that possesses the following
    14·1 answer
  • PLEASE HELP ITS DUE NOW
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!