1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scoray [572]
3 years ago
15

Why is there so much oil in the Middle East? Select the best answer from the choices below.

Biology
2 answers:
Ierofanga [76]3 years ago
7 0
A. over millions of years tectonic plates shifted...
MissTica3 years ago
6 0

Answer:

A

Explanation:

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Match these examples with the correct level of organization. Please hurry!!!
irina [24]

Answer:

Organ systems: human body and circulatory system

organs: heart

tissue: muscle

Explanation:

8 0
4 years ago
Read 2 more answers
How do i use diatoms in a sentence
Scrat [10]
Be found along with the diatoms and Radiolarla, in the uppermost 
4 0
3 years ago
Which laboratory technique would be used to determine the energy content of food items?
skelet666 [1.2K]

the technique of calorymetry is used to determine the energy content of food items.

8 0
3 years ago
Read 2 more answers
In plants, chloroplasts are necessary for A. respiration. B. photosynthesis. C. secretion. D. both respiration AND secretion. E.
Ksivusya [100]

Answer:

B- Photosynthesis

Explanation:

Chloroplasts are <em>chlorophyll-containing, eukaryotic cell structures</em> that function in photosynthesis by absorbing energy from sunlight, combining this energy with water and CO2 to convert them to sugars . This cell structure is known as a plastid. The sugars produced, are important for the survival of the plant.

Chloroplasts reproduce on their own, independent of the whole cell because they contain their own DNA. Plant chloroplasts are located  in guard cells in plant leaves. Closely linked to these guard cells are tiny pores called stomata, which allow gas exchange required for photosynthesis.

Photosynthesis occurs in two stages:

  1. The light reaction stage
  2. The dark reaction stage

The Light reaction stage takes place in the presence of light. Clorophyll converts light into chemical energy in the form of ATP and NADPH. Both molecules produced, are used in the dark stage to produce sugar.

In the dark reaction stage, the stroma, containing enzymes, facilitates reactions leading to the production of sugars from ATP and NADPH. This process is also called the carbon fixation stage. The sugar produced can be stored in the form of starch for other processes such as respiration.

8 0
4 years ago
Read 2 more answers
Other questions:
  • Transuranic waste comes mostly from used clothing and medical wastes. <br><br> True Or False ???
    12·2 answers
  • The mechanisms and processes which lead to new species
    6·1 answer
  • which of the following is the heaviest and fastest of all the small wildcats is the _______. a. jaguar b. tiger c. caracal d. bo
    14·2 answers
  • Chromosomes that code for the same traits (but often different versions of those traits) are called type your answer...
    12·1 answer
  • What are the two main organs of the cardiorespiratory system?
    10·2 answers
  • As we move above up from one tropic level to another in an energy pyramid, what happens to the energy?
    11·2 answers
  • What was “black Monday ” ? How did “black Monday” affect the direction of wilkin’s career?
    5·1 answer
  • PLZZ HELP!
    8·2 answers
  • \What is the primary function of Glucose?
    13·2 answers
  • The frequency of a wave does not change as it passes from one medium to another.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!