Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
Answer:
Organ systems: human body and circulatory system
organs: heart
tissue: muscle
Explanation:
Be found along with the diatoms and Radiolarla, in the uppermost
the technique of calorymetry is used to determine the energy content of food items.
Answer:
B- Photosynthesis
Explanation:
Chloroplasts are <em>chlorophyll-containing, eukaryotic cell structures</em> that function in photosynthesis by absorbing energy from sunlight, combining this energy with water and CO2 to convert them to sugars . This cell structure is known as a plastid. The sugars produced, are important for the survival of the plant.
Chloroplasts reproduce on their own, independent of the whole cell because they contain their own DNA. Plant chloroplasts are located in guard cells in plant leaves. Closely linked to these guard cells are tiny pores called stomata, which allow gas exchange required for photosynthesis.
Photosynthesis occurs in two stages:
- The light reaction stage
- The dark reaction stage
The Light reaction stage takes place in the presence of light. Clorophyll converts light into chemical energy in the form of ATP and NADPH. Both molecules produced, are used in the dark stage to produce sugar.
In the dark reaction stage, the stroma, containing enzymes, facilitates reactions leading to the production of sugars from ATP and NADPH. This process is also called the carbon fixation stage. The sugar produced can be stored in the form of starch for other processes such as respiration.
